WMU74712 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTTCTTTAAGACGCCGCCGCGTCCCGCCATGTTGCTCTGGCCGGAGAGGATGAAGATCCGCTTGTTTGGAGGTGGATTGAGTGTTGGATTTGTCTGGATCGGATTTGGATCGGTTGTCGCCGCCATGATTTTGATGATAGGATGGCTGTATAGCACGGCGGTGGTTGGGGGGTGTTT
BLAST of WMU74712 vs. NCBI nr
Match: gi|449438359|ref|XP_004136956.1| (PREDICTED: probable carbohydrate esterase At4g34215 [Cucumis sativus]) HSP 1 Score: 62.8 bits (151), Expect = 2.4e-07 Identity = 32/42 (76.19%), Postives = 35/42 (83.33%), Query Frame = -1
BLAST of WMU74712 vs. NCBI nr
Match: gi|659110012|ref|XP_008455001.1| (PREDICTED: probable carbohydrate esterase At4g34215 [Cucumis melo]) HSP 1 Score: 59.7 bits (143), Expect = 2.0e-06 Identity = 30/42 (71.43%), Postives = 34/42 (80.95%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|