WMU73645 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTGACAGCTTCCAAGAATTTGGGAGTAAATCCATGGATGGAATGGAGTCGGCATTTTCACAAGTATCTGGTAGGCCAACTTGGGCTGAAGGGAATTTTGAGGATGAGAAGCTGGATCAATGAACTGGAATTGTGAAGGGGATTTTGGGAAAATGGGAGATGGGAATTTGAGAGGGGTTTGTGACGATGGTGATCTTAATGCCGCGAGATGCAAAGAGCTTGGCCATGTCGACGATGGGAATCATGTGGCCGTGAGC
BLAST of WMU73645 vs. TAIR10
Match: AT2G15490.1 (AT2G15490.1 UDP-glycosyltransferase 73B4) HSP 1 Score: 58.5 bits (140), Expect = 2.3e-09 Identity = 33/76 (43.42%), Postives = 39/76 (51.32%), Query Frame = -1
BLAST of WMU73645 vs. TAIR10
Match: AT4G34131.1 (AT4G34131.1 UDP-glucosyl transferase 73B3) HSP 1 Score: 54.7 bits (130), Expect = 3.3e-08 Identity = 33/79 (41.77%), Postives = 38/79 (48.10%), Query Frame = -1
BLAST of WMU73645 vs. TAIR10
Match: AT2G15480.1 (AT2G15480.1 UDP-glucosyl transferase 73B5) HSP 1 Score: 54.7 bits (130), Expect = 3.3e-08 Identity = 33/76 (43.42%), Postives = 38/76 (50.00%), Query Frame = -1
BLAST of WMU73645 vs. TAIR10
Match: AT4G34138.1 (AT4G34138.1 UDP-glucosyl transferase 73B1) HSP 1 Score: 52.8 bits (125), Expect = 1.2e-07 Identity = 32/78 (41.03%), Postives = 39/78 (50.00%), Query Frame = -1
BLAST of WMU73645 vs. TAIR10
Match: AT4G34135.1 (AT4G34135.1 UDP-glucosyltransferase 73B2) HSP 1 Score: 50.4 bits (119), Expect = 6.2e-07 Identity = 32/79 (40.51%), Postives = 38/79 (48.10%), Query Frame = -1
BLAST of WMU73645 vs. Swiss-Prot
Match: SCGT_TOBAC (Scopoletin glucosyltransferase OS=Nicotiana tabacum GN=TOGT1 PE=1 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.1e-09 Identity = 37/88 (42.05%), Postives = 44/88 (50.00%), Query Frame = -1
BLAST of WMU73645 vs. Swiss-Prot
Match: U73B4_ARATH (UDP-glycosyltransferase 73B4 OS=Arabidopsis thaliana GN=UGT73B4 PE=2 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 4.0e-08 Identity = 33/76 (43.42%), Postives = 39/76 (51.32%), Query Frame = -1
BLAST of WMU73645 vs. Swiss-Prot
Match: U73B3_ARATH (UDP-glycosyltransferase 73B3 OS=Arabidopsis thaliana GN=UGT73B3 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 5.8e-07 Identity = 33/79 (41.77%), Postives = 38/79 (48.10%), Query Frame = -1
BLAST of WMU73645 vs. Swiss-Prot
Match: U73B5_ARATH (UDP-glycosyltransferase 73B5 OS=Arabidopsis thaliana GN=UGT73B5 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 5.8e-07 Identity = 33/76 (43.42%), Postives = 38/76 (50.00%), Query Frame = -1
BLAST of WMU73645 vs. Swiss-Prot
Match: UFOG7_FRAAN (UDP-glucose flavonoid 3-O-glucosyltransferase 7 OS=Fragaria ananassa GN=GT7 PE=1 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.7e-06 Identity = 31/78 (39.74%), Postives = 39/78 (50.00%), Query Frame = -1
BLAST of WMU73645 vs. NCBI nr
Match: gi|778725042|ref|XP_011658893.1| (PREDICTED: scopoletin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 2.9e-14 Identity = 49/79 (62.03%), Postives = 51/79 (64.56%), Query Frame = -1
BLAST of WMU73645 vs. NCBI nr
Match: gi|659109956|ref|XP_008454970.1| (PREDICTED: scopoletin glucosyltransferase-like [Cucumis melo]) HSP 1 Score: 82.4 bits (202), Expect = 4.1e-13 Identity = 47/89 (52.81%), Postives = 54/89 (60.67%), Query Frame = -1
BLAST of WMU73645 vs. NCBI nr
Match: gi|778725045|ref|XP_011658894.1| (PREDICTED: scopoletin glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 79.0 bits (193), Expect = 4.6e-12 Identity = 45/81 (55.56%), Postives = 54/81 (66.67%), Query Frame = -1
BLAST of WMU73645 vs. NCBI nr
Match: gi|659109952|ref|XP_008454968.1| (PREDICTED: scopoletin glucosyltransferase-like [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 4.6e-12 Identity = 46/81 (56.79%), Postives = 54/81 (66.67%), Query Frame = -1
BLAST of WMU73645 vs. NCBI nr
Match: gi|224103637|ref|XP_002313133.1| (hypothetical protein POPTR_0009s10120g [Populus trichocarpa]) HSP 1 Score: 70.1 bits (170), Expect = 2.1e-09 Identity = 40/88 (45.45%), Postives = 49/88 (55.68%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|