WMU73430 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGAGAGATTAATCCCAAGGATATGAACTTTGGAGCGCTTCGTCGCCCAGCTCGAGCTCTCCGGCCGGCCATCGCTTGTCGGTCTGATCAAGAACCAAACCGCCGAAAACCGCCCGGTTTCTTGCCTGATCTTGAACCCTTTTTGCCATGGACTTACGAAGTTGCAGAGGAGCTTCAAATCCCCTGTGCCATTCTTTGGGTTCAATCTTGCGCTCTGTTCTCAATTTATTATCATCATTTTCCACAAATCCGCTCCGTTTCCTTCTGAAATTTGAACCCAAAAATCGATGTTCATCTCCCGATTTTGCCACTTTTGTAAGAACGATGAAATCCCAAGCTTCTTAGT
BLAST of WMU73430 vs. TAIR10
Match: AT4G15480.1 (AT4G15480.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 73.6 bits (179), Expect = 9.2e-14 Identity = 36/61 (59.02%), Postives = 41/61 (67.21%), Query Frame = 1
BLAST of WMU73430 vs. TAIR10
Match: AT3G21560.1 (AT3G21560.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 61.6 bits (148), Expect = 3.6e-10 Identity = 30/61 (49.18%), Postives = 39/61 (63.93%), Query Frame = 1
BLAST of WMU73430 vs. TAIR10
Match: AT4G15490.1 (AT4G15490.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-09 Identity = 31/60 (51.67%), Postives = 36/60 (60.00%), Query Frame = 1
BLAST of WMU73430 vs. TAIR10
Match: AT4G15500.1 (AT4G15500.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 58.9 bits (141), Expect = 2.3e-09 Identity = 29/59 (49.15%), Postives = 37/59 (62.71%), Query Frame = 1
BLAST of WMU73430 vs. TAIR10
Match: AT2G23210.1 (AT2G23210.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 58.5 bits (140), Expect = 3.1e-09 Identity = 32/70 (45.71%), Postives = 42/70 (60.00%), Query Frame = 1
BLAST of WMU73430 vs. Swiss-Prot
Match: U84A1_ARATH (UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana GN=UGT84A1 PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.6e-12 Identity = 36/61 (59.02%), Postives = 41/61 (67.21%), Query Frame = 1
BLAST of WMU73430 vs. Swiss-Prot
Match: F6CGT_GENTR (UDP-glycosyltransferase UF6CGT1 OS=Gentiana triflora GN=UF6CGT1 PE=2 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 6.8e-11 Identity = 35/63 (55.56%), Postives = 40/63 (63.49%), Query Frame = 1
HSP 2 Score: 38.1 bits (87), Expect = 7.5e-02 Identity = 26/102 (25.49%), Postives = 39/102 (38.24%), Query Frame = 2
BLAST of WMU73430 vs. Swiss-Prot
Match: UGT_FRAAN (Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa GN=GT5 PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.2e-10 Identity = 32/61 (52.46%), Postives = 39/61 (63.93%), Query Frame = 1
BLAST of WMU73430 vs. Swiss-Prot
Match: LGT_CITUN (Limonoid UDP-glucosyltransferase OS=Citrus unshiu PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.2e-10 Identity = 33/61 (54.10%), Postives = 41/61 (67.21%), Query Frame = 1
HSP 2 Score: 62.4 bits (150), Expect = 3.7e-09 Identity = 40/111 (36.04%), Postives = 53/111 (47.75%), Query Frame = 2
BLAST of WMU73430 vs. Swiss-Prot
Match: U84A2_ARATH (UDP-glycosyltransferase 84A2 OS=Arabidopsis thaliana GN=UGT84A2 PE=1 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 6.4e-09 Identity = 30/61 (49.18%), Postives = 39/61 (63.93%), Query Frame = 1
BLAST of WMU73430 vs. NCBI nr
Match: gi|659109998|ref|XP_008454994.1| (PREDICTED: limonoid UDP-glucosyltransferase-like [Cucumis melo]) HSP 1 Score: 97.8 bits (242), Expect = 1.3e-17 Identity = 58/112 (51.79%), Postives = 69/112 (61.61%), Query Frame = 2
BLAST of WMU73430 vs. NCBI nr
Match: gi|449438647|ref|XP_004137099.1| (PREDICTED: limonoid UDP-glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 92.8 bits (229), Expect = 4.1e-16 Identity = 50/105 (47.62%), Postives = 61/105 (58.10%), Query Frame = 1
BLAST of WMU73430 vs. NCBI nr
Match: gi|1009150082|ref|XP_015892825.1| (PREDICTED: putative UDP-glucose glucosyltransferase [Ziziphus jujuba]) HSP 1 Score: 77.8 bits (190), Expect = 1.4e-11 Identity = 36/61 (59.02%), Postives = 47/61 (77.05%), Query Frame = 1
BLAST of WMU73430 vs. NCBI nr
Match: gi|565378682|ref|XP_006355777.1| (PREDICTED: cinnamate beta-D-glucosyltransferase-like [Solanum tuberosum]) HSP 1 Score: 77.0 bits (188), Expect = 2.4e-11 Identity = 36/61 (59.02%), Postives = 43/61 (70.49%), Query Frame = 1
BLAST of WMU73430 vs. NCBI nr
Match: gi|565476443|ref|XP_006295862.1| (hypothetical protein CARUB_v10024992mg [Capsella rubella]) HSP 1 Score: 77.0 bits (188), Expect = 2.4e-11 Identity = 37/61 (60.66%), Postives = 44/61 (72.13%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|