WMU72845 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGCAACCAATCTGGTGTAACCGAATTCGCCTCCACGGTACATCGACCGTTTTGGTTGTGGGAAGATCGGGTCATCTGGGTGGTTTGGTCTTGGCTCCCAGATTGGTTGCCAATCTTGTCCAGCCATTCCGATGACGAGATGGATGGGGTAATGCTTCCCAGTCTTCCCCATCCACACCCATACTTCCACA
BLAST of WMU72845 vs. TAIR10
Match: AT1G13900.1 (AT1G13900.1 Purple acid phosphatases superfamily protein) HSP 1 Score: 100.9 bits (250), Expect = 2.9e-22 Identity = 44/57 (77.19%), Postives = 46/57 (80.70%), Query Frame = -2
BLAST of WMU72845 vs. TAIR10
Match: AT2G03450.1 (AT2G03450.1 purple acid phosphatase 9) HSP 1 Score: 87.8 bits (216), Expect = 2.6e-18 Identity = 40/57 (70.18%), Postives = 41/57 (71.93%), Query Frame = -2
BLAST of WMU72845 vs. Swiss-Prot
Match: PPA2_ARATH (Probable inactive purple acid phosphatase 2 OS=Arabidopsis thaliana GN=PAP2 PE=2 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 5.2e-21 Identity = 44/57 (77.19%), Postives = 46/57 (80.70%), Query Frame = -2
BLAST of WMU72845 vs. Swiss-Prot
Match: PPA9_ARATH (Probable inactive purple acid phosphatase 9 OS=Arabidopsis thaliana GN=PAP9 PE=2 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 4.6e-17 Identity = 40/57 (70.18%), Postives = 41/57 (71.93%), Query Frame = -2
BLAST of WMU72845 vs. NCBI nr
Match: gi|449452086|ref|XP_004143791.1| (PREDICTED: probable inactive purple acid phosphatase 2 [Cucumis sativus]) HSP 1 Score: 114.8 bits (286), Expect = 5.6e-23 Identity = 48/55 (87.27%), Postives = 51/55 (92.73%), Query Frame = -2
BLAST of WMU72845 vs. NCBI nr
Match: gi|659131467|ref|XP_008465701.1| (PREDICTED: probable inactive purple acid phosphatase 2 [Cucumis melo]) HSP 1 Score: 114.8 bits (286), Expect = 5.6e-23 Identity = 48/55 (87.27%), Postives = 51/55 (92.73%), Query Frame = -2
BLAST of WMU72845 vs. NCBI nr
Match: gi|568859056|ref|XP_006483058.1| (PREDICTED: probable inactive purple acid phosphatase 2 [Citrus sinensis]) HSP 1 Score: 111.3 bits (277), Expect = 6.2e-22 Identity = 45/59 (76.27%), Postives = 53/59 (89.83%), Query Frame = -2
BLAST of WMU72845 vs. NCBI nr
Match: gi|729450690|ref|XP_010523486.1| (PREDICTED: probable inactive purple acid phosphatase 2 [Tarenaya hassleriana]) HSP 1 Score: 111.3 bits (277), Expect = 6.2e-22 Identity = 47/55 (85.45%), Postives = 50/55 (90.91%), Query Frame = -2
BLAST of WMU72845 vs. NCBI nr
Match: gi|1012365243|gb|KYP76425.1| (putative inactive purple acid phosphatase 2 [Cajanus cajan]) HSP 1 Score: 109.8 bits (273), Expect = 1.8e-21 Identity = 45/52 (86.54%), Postives = 49/52 (94.23%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|