WMU72615 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GAAGATATACAAGGATCTTTCCTTAAGCTCTGTGTTTCTGATGAACAATGGGCGATACATTGTTCAGAAAGTGAAAGACAGTGAATTAGGGTCAGTTTTAGGCGAGGATTGGATTCGAAAACACTCGGTTAAAAACCGGCAATACCTTGGAAACTACCTGAAAAGCTCATGGAGCAAGGTGGTCGGGGCATTGAAAATGGACAGTGGCACTATAGCTCCGGCTGTGATGAAGGAGAAGCTCCAATCATTCAATATGCAATTTGTAAGAAATACTGCCAAACCCCAAACTCCACCATGGGTGGATATTTGTAGCATCAGCTTAGAGAAGAAGCAAGAATCTCAGTTGC
BLAST of WMU72615 vs. TAIR10
Match: AT5G58430.1 (AT5G58430.1 exocyst subunit exo70 family protein B1) HSP 1 Score: 110.2 bits (274), Expect = 8.9e-25 Identity = 54/91 (59.34%), Postives = 67/91 (73.63%), Query Frame = 2
BLAST of WMU72615 vs. TAIR10
Match: AT1G07000.1 (AT1G07000.1 exocyst subunit exo70 family protein B2) HSP 1 Score: 87.8 bits (216), Expect = 4.7e-18 Identity = 46/87 (52.87%), Postives = 57/87 (65.52%), Query Frame = 2
BLAST of WMU72615 vs. TAIR10
Match: AT5G50380.1 (AT5G50380.1 exocyst subunit exo70 family protein F1) HSP 1 Score: 85.1 bits (209), Expect = 3.0e-17 Identity = 44/102 (43.14%), Postives = 59/102 (57.84%), Query Frame = 2
BLAST of WMU72615 vs. TAIR10
Match: AT5G13990.1 (AT5G13990.1 exocyst subunit exo70 family protein C2) HSP 1 Score: 81.6 bits (200), Expect = 3.4e-16 Identity = 42/92 (45.65%), Postives = 57/92 (61.96%), Query Frame = 2
BLAST of WMU72615 vs. TAIR10
Match: AT5G13150.1 (AT5G13150.1 exocyst subunit exo70 family protein C1) HSP 1 Score: 78.6 bits (192), Expect = 2.9e-15 Identity = 37/92 (40.22%), Postives = 58/92 (63.04%), Query Frame = 2
BLAST of WMU72615 vs. Swiss-Prot
Match: E70B1_ARATH (Exocyst complex component EXO70B1 OS=Arabidopsis thaliana GN=EXO70B1 PE=1 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.6e-23 Identity = 54/91 (59.34%), Postives = 67/91 (73.63%), Query Frame = 2
BLAST of WMU72615 vs. Swiss-Prot
Match: E70A1_ARATH (Exocyst complex component EXO70A1 OS=Arabidopsis thaliana GN=EXO70A1 PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.4e-10 Identity = 34/101 (33.66%), Postives = 59/101 (58.42%), Query Frame = 2
BLAST of WMU72615 vs. NCBI nr
Match: gi|449474977|ref|XP_004154337.1| (PREDICTED: exocyst complex component EXO70B1 [Cucumis sativus]) HSP 1 Score: 171.0 bits (432), Expect = 1.2e-39 Identity = 83/87 (95.40%), Postives = 86/87 (98.85%), Query Frame = 2
BLAST of WMU72615 vs. NCBI nr
Match: gi|659114995|ref|XP_008457332.1| (PREDICTED: exocyst complex component EXO70B1-like [Cucumis melo]) HSP 1 Score: 171.0 bits (432), Expect = 1.2e-39 Identity = 83/87 (95.40%), Postives = 86/87 (98.85%), Query Frame = 2
BLAST of WMU72615 vs. NCBI nr
Match: gi|470117222|ref|XP_004294760.1| (PREDICTED: exocyst complex component EXO70B1-like [Fragaria vesca subsp. vesca]) HSP 1 Score: 126.7 bits (317), Expect = 2.6e-26 Identity = 62/91 (68.13%), Postives = 75/91 (82.42%), Query Frame = 2
BLAST of WMU72615 vs. NCBI nr
Match: gi|720085329|ref|XP_010243483.1| (PREDICTED: exocyst complex component EXO70B1 [Nelumbo nucifera]) HSP 1 Score: 124.4 bits (311), Expect = 1.3e-25 Identity = 58/91 (63.74%), Postives = 76/91 (83.52%), Query Frame = 2
BLAST of WMU72615 vs. NCBI nr
Match: gi|729434815|ref|XP_010520187.1| (PREDICTED: exocyst complex component EXO70B1 [Tarenaya hassleriana]) HSP 1 Score: 122.9 bits (307), Expect = 3.7e-25 Identity = 57/86 (66.28%), Postives = 69/86 (80.23%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|