WMU70428 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATGTCATGCTCAGGCAGCAGCACAAGCAGTGAAATGAGTGGACAAGAAAAGGAATTGGCTGGAATCTCACCGGGGCTCGTGAGAATGTCTATTGGATATATGGGTACATTGGAGCAAAAATGGAGCCAATTTGAGAAGGCTCTTGCCAAAAGTCCAAGACACGGGGCCTTTTCAATTTCCAACAATTAATTAATTATACATCGATTTTGAATCTCTTCTTTTATAAATTCGATCGGTTCGGTTCTTCATGGCTCCAAAACTGACAAAATCGAACCGACTTTCACCTTTAATATGTATAGACATTGTTTAATTATGAGTATGATGTTTTTTCTAAAAATTAAATGAATAAACGCATGTA
BLAST of WMU70428 vs. TAIR10
Match: AT1G64660.1 (AT1G64660.1 methionine gamma-lyase) HSP 1 Score: 62.0 bits (149), Expect = 2.9e-10 Identity = 27/35 (77.14%), Postives = 30/35 (85.71%), Query Frame = 1
BLAST of WMU70428 vs. Swiss-Prot
Match: MGL_ARATH (Methionine gamma-lyase OS=Arabidopsis thaliana GN=MGL PE=1 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 5.1e-09 Identity = 27/35 (77.14%), Postives = 30/35 (85.71%), Query Frame = 1
BLAST of WMU70428 vs. NCBI nr
Match: gi|449456795|ref|XP_004146134.1| (PREDICTED: methionine gamma-lyase-like [Cucumis sativus]) HSP 1 Score: 77.4 bits (189), Expect = 1.9e-11 Identity = 36/42 (85.71%), Postives = 39/42 (92.86%), Query Frame = 1
BLAST of WMU70428 vs. NCBI nr
Match: gi|307136088|gb|ADN33936.1| (cystathionine gamma-synthase [Cucumis melo subsp. melo]) HSP 1 Score: 76.3 bits (186), Expect = 4.2e-11 Identity = 35/37 (94.59%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of WMU70428 vs. NCBI nr
Match: gi|659095405|ref|XP_008448562.1| (PREDICTED: methionine gamma-lyase-like [Cucumis melo]) HSP 1 Score: 76.3 bits (186), Expect = 4.2e-11 Identity = 35/37 (94.59%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of WMU70428 vs. NCBI nr
Match: gi|451811145|gb|AGF70153.1| (methionine gamma-lyase [Cucumis melo]) HSP 1 Score: 76.3 bits (186), Expect = 4.2e-11 Identity = 35/37 (94.59%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of WMU70428 vs. NCBI nr
Match: gi|703112738|ref|XP_010100197.1| (Methionine gamma-lyase [Morus notabilis]) HSP 1 Score: 71.6 bits (174), Expect = 1.0e-09 Identity = 31/44 (70.45%), Postives = 39/44 (88.64%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|