WMU69867 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTTTAAATGTATTTACCCTGGTGAACTTGGGATTTTGCTGGAAAGCAGCGTGGCAAGTAAAGAATCCGACATCTACAGCTTCGGAATCGTGTGCTTGGAAATCGCCGAAGAAGGAGTGTGATTGAGGCTGCCGACCAGAAATTGCGGCAAAATTTCAAAAGAGAAGAGATGAACCAACTGTTGATCATAGGACTTGCCTGTGCTCAGCCGGATTTCTCTCTACGGCCTTCCATCAAACAGGTAATCGACATGCTTATCTTCACATCGCCATCGCCGAATCTGCCATTGGAAT
BLAST of WMU69867 vs. TAIR10
Match: AT5G65600.1 (AT5G65600.1 Concanavalin A-like lectin protein kinase family protein) HSP 1 Score: 57.8 bits (138), Expect = 4.4e-09 Identity = 27/58 (46.55%), Postives = 38/58 (65.52%), Query Frame = 1
HSP 2 Score: 33.5 bits (75), Expect = 8.9e-02 Identity = 16/17 (94.12%), Postives = 14/17 (82.35%), Query Frame = 2
BLAST of WMU69867 vs. TAIR10
Match: AT5G10530.1 (AT5G10530.1 Concanavalin A-like lectin protein kinase family protein) HSP 1 Score: 53.5 bits (127), Expect = 8.3e-08 Identity = 28/57 (49.12%), Postives = 36/57 (63.16%), Query Frame = 1
HSP 2 Score: 32.7 bits (73), Expect = 1.5e-01 Identity = 14/17 (82.35%), Postives = 14/17 (82.35%), Query Frame = 2
BLAST of WMU69867 vs. TAIR10
Match: AT5G55830.1 (AT5G55830.1 Concanavalin A-like lectin protein kinase family protein) HSP 1 Score: 51.6 bits (122), Expect = 3.2e-07 Identity = 25/58 (43.10%), Postives = 38/58 (65.52%), Query Frame = 1
BLAST of WMU69867 vs. TAIR10
Match: AT5G42120.1 (AT5G42120.1 Concanavalin A-like lectin protein kinase family protein) HSP 1 Score: 51.2 bits (121), Expect = 4.1e-07 Identity = 22/56 (39.29%), Postives = 34/56 (60.71%), Query Frame = 1
BLAST of WMU69867 vs. TAIR10
Match: AT3G53380.1 (AT3G53380.1 Concanavalin A-like lectin protein kinase family protein) HSP 1 Score: 49.3 bits (116), Expect = 1.6e-06 Identity = 23/56 (41.07%), Postives = 34/56 (60.71%), Query Frame = 1
BLAST of WMU69867 vs. Swiss-Prot
Match: LRK92_ARATH (L-type lectin-domain containing receptor kinase IX.2 OS=Arabidopsis thaliana GN=LECRK92 PE=1 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.8e-08 Identity = 27/58 (46.55%), Postives = 38/58 (65.52%), Query Frame = 1
HSP 2 Score: 33.5 bits (75), Expect = 1.6e+00 Identity = 16/17 (94.12%), Postives = 14/17 (82.35%), Query Frame = 2
BLAST of WMU69867 vs. Swiss-Prot
Match: LRK91_ARATH (L-type lectin-domain containing receptor kinase IX.1 OS=Arabidopsis thaliana GN=LECRK91 PE=1 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.5e-06 Identity = 28/57 (49.12%), Postives = 36/57 (63.16%), Query Frame = 1
HSP 2 Score: 32.7 bits (73), Expect = 2.7e+00 Identity = 14/17 (82.35%), Postives = 14/17 (82.35%), Query Frame = 2
BLAST of WMU69867 vs. Swiss-Prot
Match: LRKS7_ARATH (Probable L-type lectin-domain containing receptor kinase S.7 OS=Arabidopsis thaliana GN=LECRKS7 PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 5.6e-06 Identity = 25/58 (43.10%), Postives = 38/58 (65.52%), Query Frame = 1
BLAST of WMU69867 vs. Swiss-Prot
Match: LRKS6_ARATH (L-type lectin-domain containing receptor kinase S.6 OS=Arabidopsis thaliana GN=LECRKS6 PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 7.3e-06 Identity = 22/56 (39.29%), Postives = 34/56 (60.71%), Query Frame = 1
BLAST of WMU69867 vs. NCBI nr
Match: gi|778724631|ref|XP_004137072.2| (PREDICTED: L-type lectin-domain containing receptor kinase IX.1-like [Cucumis sativus]) HSP 1 Score: 100.1 bits (248), Expect = 2.2e-18 Identity = 50/59 (84.75%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of WMU69867 vs. NCBI nr
Match: gi|802573647|ref|XP_012068412.1| (PREDICTED: L-type lectin-domain containing receptor kinase IX.1-like [Jatropha curcas]) HSP 1 Score: 69.3 bits (168), Expect = 4.1e-09 Identity = 30/56 (53.57%), Postives = 43/56 (76.79%), Query Frame = 1
BLAST of WMU69867 vs. NCBI nr
Match: gi|1009149606|ref|XP_015892567.1| (PREDICTED: L-type lectin-domain containing receptor kinase IX.1-like [Ziziphus jujuba]) HSP 1 Score: 68.6 bits (166), Expect = 7.1e-09 Identity = 33/58 (56.90%), Postives = 44/58 (75.86%), Query Frame = 1
BLAST of WMU69867 vs. NCBI nr
Match: gi|1009148916|ref|XP_015892196.1| (PREDICTED: L-type lectin-domain containing receptor kinase IX.1-like [Ziziphus jujuba]) HSP 1 Score: 67.4 bits (163), Expect = 1.6e-08 Identity = 30/56 (53.57%), Postives = 43/56 (76.79%), Query Frame = 1
BLAST of WMU69867 vs. NCBI nr
Match: gi|920687914|gb|KOM31897.1| (hypothetical protein LR48_Vigan01g145300 [Vigna angularis]) HSP 1 Score: 67.0 bits (162), Expect = 2.1e-08 Identity = 29/56 (51.79%), Postives = 43/56 (76.79%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|