WMU69371 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CGATAATAGCATCACAATGATTATGTACTTCTAACCATTCCTGAAAGCTTATAAAATTTGGTTGAGTCTCCCTTTCAATGGCAAGTGCAGCCAAAGACTGAGCAAAGCTCTCAGTCTCAGCACAACTAATATCGACACAGACCAACTGCTGAGCACAACAGCAACATTTGCCACTGGAATCAACATTTGTTCTTTTCACTGTCCAACTTCCCTTCCCAATCCACCCCTTTCCATGCCAA
BLAST of WMU69371 vs. TAIR10
Match: AT2G32230.1 (AT2G32230.1 proteinaceous RNase P 1) HSP 1 Score: 108.2 bits (269), Expect = 2.3e-24 Identity = 46/79 (58.23%), Postives = 55/79 (69.62%), Query Frame = -2
BLAST of WMU69371 vs. TAIR10
Match: AT2G16650.1 (AT2G16650.1 proteinaceous RNase P 2) HSP 1 Score: 97.1 bits (240), Expect = 5.3e-21 Identity = 42/86 (48.84%), Postives = 56/86 (65.12%), Query Frame = -2
BLAST of WMU69371 vs. TAIR10
Match: AT5G60430.1 (AT5G60430.1 drug transmembrane transporters;antiporters) HSP 1 Score: 93.2 bits (230), Expect = 7.7e-20 Identity = 41/86 (47.67%), Postives = 53/86 (61.63%), Query Frame = -2
BLAST of WMU69371 vs. TAIR10
Match: AT4G21900.1 (AT4G21900.1 proteinaceous RNase P 3) HSP 1 Score: 92.0 bits (227), Expect = 1.7e-19 Identity = 42/86 (48.84%), Postives = 51/86 (59.30%), Query Frame = -2
BLAST of WMU69371 vs. Swiss-Prot
Match: PRRP1_ARATH (Proteinaceous RNase P 1, chloroplastic/mitochondrial OS=Arabidopsis thaliana GN=PRORP1 PE=1 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 4.1e-23 Identity = 46/79 (58.23%), Postives = 55/79 (69.62%), Query Frame = -2
BLAST of WMU69371 vs. Swiss-Prot
Match: PRRP2_ARATH (Proteinaceous RNase P 2 OS=Arabidopsis thaliana GN=PRORP2 PE=1 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 9.5e-20 Identity = 42/86 (48.84%), Postives = 56/86 (65.12%), Query Frame = -2
BLAST of WMU69371 vs. Swiss-Prot
Match: PRRP3_ARATH (Proteinaceous RNase P 3 OS=Arabidopsis thaliana GN=PRORP3 PE=1 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.0e-18 Identity = 42/86 (48.84%), Postives = 51/86 (59.30%), Query Frame = -2
BLAST of WMU69371 vs. NCBI nr
Match: gi|659083089|ref|XP_008442179.1| (PREDICTED: proteinaceous RNase P 2-like [Cucumis melo]) HSP 1 Score: 159.5 bits (402), Expect = 2.5e-36 Identity = 71/79 (89.87%), Postives = 76/79 (96.20%), Query Frame = -2
BLAST of WMU69371 vs. NCBI nr
Match: gi|778695037|ref|XP_004151049.2| (PREDICTED: proteinaceous RNase P 2 [Cucumis sativus]) HSP 1 Score: 157.1 bits (396), Expect = 1.2e-35 Identity = 72/79 (91.14%), Postives = 75/79 (94.94%), Query Frame = -2
BLAST of WMU69371 vs. NCBI nr
Match: gi|700199678|gb|KGN54836.1| (hypothetical protein Csa_4G526560 [Cucumis sativus]) HSP 1 Score: 127.5 bits (319), Expect = 1.0e-26 Identity = 62/75 (82.67%), Postives = 64/75 (85.33%), Query Frame = -2
BLAST of WMU69371 vs. NCBI nr
Match: gi|764543912|ref|XP_011459350.1| (PREDICTED: proteinaceous RNase P 2 [Fragaria vesca subsp. vesca]) HSP 1 Score: 115.2 bits (287), Expect = 5.4e-23 Identity = 50/79 (63.29%), Postives = 61/79 (77.22%), Query Frame = -2
BLAST of WMU69371 vs. NCBI nr
Match: gi|950954641|ref|XP_014496470.1| (PREDICTED: proteinaceous RNase P 2-like [Vigna radiata var. radiata]) HSP 1 Score: 112.5 bits (280), Expect = 3.5e-22 Identity = 48/79 (60.76%), Postives = 59/79 (74.68%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|