WMU68606 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TAGGATACAACCATAGAGGCAGAAGGATTGTTAGGAAGAAGAGGAACGGGTGAAGTCTTGTGTCATACAGGACTCGGTTTTTCTGTTTCCTGCTGGCTACCACGCTCCTCGTCACTTCCTTGACCCCCCTTGATATCCATTCTGACAAAAAATACTTAGTTTTACTGAAGGCAAATTCTTTTTGGCTTTCCGACTACCTTCAACCTTCCATAGATCCCAAAACTCGGGTTTTCGGTGGAGGAGTTGCCTCTGCAATTGGAGCAACAAGTCCAGGCTTCCCATCATCAATAACTTCATCGA
BLAST of WMU68606 vs. TAIR10
Match: AT1G66670.1 (AT1G66670.1 CLP protease proteolytic subunit 3) HSP 1 Score: 49.3 bits (116), Expect = 1.6e-06 Identity = 23/34 (67.65%), Postives = 25/34 (73.53%), Query Frame = -3
HSP 2 Score: 39.3 bits (90), Expect = 1.7e-03 Identity = 18/33 (54.55%), Postives = 20/33 (60.61%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|