WMU68320 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATTTGAGGATGGGAATACGAAAGTTGAGCTACAGAGGACCAGGGCCATTTTATTTCATCAGTGGGGCAAAGGGCCATTGCGAGCAAGGGCCAGAAGCTGATCGTTGTGGTTGTGACTCCTCGCCGCAGGTTCATCGGCATCTCTTCGGCGCCTTTCTCCCCGCGGAGAGTGAGGGTCCGGCGGTTGCTCCGTCGAGTGGAGCTGCAAATTTGAAGGTTGGACTTTTGGCGGTGATCGTCGGAATTTTGG
BLAST of WMU68320 vs. TAIR10
Match: AT2G25060.1 (AT2G25060.1 early nodulin-like protein 14) HSP 1 Score: 49.3 bits (116), Expect = 1.3e-06 Identity = 31/80 (38.75%), Postives = 45/80 (56.25%), Query Frame = 3
BLAST of WMU68320 vs. TAIR10
Match: AT4G31840.1 (AT4G31840.1 early nodulin-like protein 15) HSP 1 Score: 47.8 bits (112), Expect = 3.8e-06 Identity = 30/79 (37.97%), Postives = 43/79 (54.43%), Query Frame = 3
BLAST of WMU68320 vs. NCBI nr
Match: gi|659088994|ref|XP_008445271.1| (PREDICTED: early nodulin-like protein 1 [Cucumis melo]) HSP 1 Score: 84.3 bits (207), Expect = 1.1e-13 Identity = 50/88 (56.82%), Postives = 53/88 (60.23%), Query Frame = 3
BLAST of WMU68320 vs. NCBI nr
Match: gi|449441860|ref|XP_004138700.1| (PREDICTED: early nodulin-like protein 1 [Cucumis sativus]) HSP 1 Score: 84.3 bits (207), Expect = 1.1e-13 Identity = 50/88 (56.82%), Postives = 53/88 (60.23%), Query Frame = 3
BLAST of WMU68320 vs. NCBI nr
Match: gi|645227754|ref|XP_008220668.1| (PREDICTED: early nodulin-like protein 1 [Prunus mume]) HSP 1 Score: 68.2 bits (165), Expect = 7.8e-09 Identity = 39/78 (50.00%), Postives = 48/78 (61.54%), Query Frame = 3
BLAST of WMU68320 vs. NCBI nr
Match: gi|596194587|ref|XP_007223558.1| (hypothetical protein PRUPE_ppa012204mg [Prunus persica]) HSP 1 Score: 67.8 bits (164), Expect = 1.0e-08 Identity = 39/78 (50.00%), Postives = 47/78 (60.26%), Query Frame = 3
BLAST of WMU68320 vs. NCBI nr
Match: gi|694356854|ref|XP_009359114.1| (PREDICTED: early nodulin-like protein 1 [Pyrus x bretschneideri]) HSP 1 Score: 66.2 bits (160), Expect = 3.0e-08 Identity = 38/79 (48.10%), Postives = 51/79 (64.56%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|