WMU68234 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATCCATGGGTTAACTCGGTCGCACTCGGTCGCCGGAATTTTCTCTTAGCGCCTTCCAAACTGCGCTGTTACACTTGAATCCGGCTCCGAACGCCACCTGCCAGATCCGGTGGACCTTTCGTGACGCGATTCTTTGCTTCTGTATATGCCAATTCGTACCACAAGGAACTACTCGACGTGTTCCCAAATCGGTACAGTGTCATCCTCGAGGGTTCCATGTGCCACTCACTCAGTTGGAGGTTCTTCTGCAGAGCGTCCAGCACTGCTCTTCCGCCGGCATGGATGCAGAAATGCTCGAATGCGAGCTTAAAATCTGGGCTTTGCGAAGTAAAAACGGTTTCTCTCTTTGCAACAGCCTAAAAAACGAAAACTTCAATCAAGAGAATTGATGGC
BLAST of WMU68234 vs. TAIR10
Match: AT2G26640.1 (AT2G26640.1 3-ketoacyl-CoA synthase 11) HSP 1 Score: 132.9 bits (333), Expect = 1.4e-31 Identity = 60/68 (88.24%), Postives = 63/68 (92.65%), Query Frame = -2
HSP 2 Score: 47.8 bits (112), Expect = 6.1e-06 Identity = 18/26 (69.23%), Postives = 22/26 (84.62%), Query Frame = -3
BLAST of WMU68234 vs. TAIR10
Match: AT5G43760.1 (AT5G43760.1 3-ketoacyl-CoA synthase 20) HSP 1 Score: 128.3 bits (321), Expect = 3.6e-30 Identity = 58/68 (85.29%), Postives = 61/68 (89.71%), Query Frame = -2
HSP 2 Score: 48.1 bits (113), Expect = 4.7e-06 Identity = 19/22 (86.36%), Postives = 19/22 (86.36%), Query Frame = -3
BLAST of WMU68234 vs. TAIR10
Match: AT1G04220.1 (AT1G04220.1 3-ketoacyl-CoA synthase 2) HSP 1 Score: 128.3 bits (321), Expect = 3.6e-30 Identity = 58/68 (85.29%), Postives = 61/68 (89.71%), Query Frame = -2
HSP 2 Score: 47.0 bits (110), Expect = 1.0e-05 Identity = 18/22 (81.82%), Postives = 19/22 (86.36%), Query Frame = -3
BLAST of WMU68234 vs. TAIR10
Match: AT1G01120.1 (AT1G01120.1 3-ketoacyl-CoA synthase 1) HSP 1 Score: 127.9 bits (320), Expect = 4.6e-30 Identity = 58/68 (85.29%), Postives = 60/68 (88.24%), Query Frame = -2
HSP 2 Score: 49.7 bits (117), Expect = 1.6e-06 Identity = 20/29 (68.97%), Postives = 23/29 (79.31%), Query Frame = -3
BLAST of WMU68234 vs. TAIR10
Match: AT2G16280.1 (AT2G16280.1 3-ketoacyl-CoA synthase 9) HSP 1 Score: 118.6 bits (296), Expect = 2.8e-27 Identity = 54/68 (79.41%), Postives = 60/68 (88.24%), Query Frame = -2
HSP 2 Score: 47.8 bits (112), Expect = 6.1e-06 Identity = 21/36 (58.33%), Postives = 26/36 (72.22%), Query Frame = -3
BLAST of WMU68234 vs. Swiss-Prot
Match: KCS11_ARATH (3-ketoacyl-CoA synthase 11 OS=Arabidopsis thaliana GN=KCS11 PE=1 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 2.6e-30 Identity = 60/68 (88.24%), Postives = 63/68 (92.65%), Query Frame = -2
HSP 2 Score: 47.8 bits (112), Expect = 1.1e-04 Identity = 18/26 (69.23%), Postives = 22/26 (84.62%), Query Frame = -3
BLAST of WMU68234 vs. Swiss-Prot
Match: KCS20_ARATH (3-ketoacyl-CoA synthase 20 OS=Arabidopsis thaliana GN=KCS20 PE=2 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 6.3e-29 Identity = 58/68 (85.29%), Postives = 61/68 (89.71%), Query Frame = -2
HSP 2 Score: 48.1 bits (113), Expect = 8.3e-05 Identity = 19/22 (86.36%), Postives = 19/22 (86.36%), Query Frame = -3
BLAST of WMU68234 vs. Swiss-Prot
Match: KCS2_ARATH (3-ketoacyl-CoA synthase 2 OS=Arabidopsis thaliana GN=KCS2 PE=2 SV=2) HSP 1 Score: 128.3 bits (321), Expect = 6.3e-29 Identity = 58/68 (85.29%), Postives = 61/68 (89.71%), Query Frame = -2
HSP 2 Score: 47.0 bits (110), Expect = 1.8e-04 Identity = 18/22 (81.82%), Postives = 19/22 (86.36%), Query Frame = -3
BLAST of WMU68234 vs. Swiss-Prot
Match: KCS1_ARATH (3-ketoacyl-CoA synthase 1 OS=Arabidopsis thaliana GN=KCS1 PE=1 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 8.2e-29 Identity = 58/68 (85.29%), Postives = 60/68 (88.24%), Query Frame = -2
HSP 2 Score: 49.7 bits (117), Expect = 2.8e-05 Identity = 20/29 (68.97%), Postives = 23/29 (79.31%), Query Frame = -3
BLAST of WMU68234 vs. Swiss-Prot
Match: KCS9_ARATH (3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana GN=KCS9 PE=2 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 5.0e-26 Identity = 54/68 (79.41%), Postives = 60/68 (88.24%), Query Frame = -2
HSP 2 Score: 47.8 bits (112), Expect = 1.1e-04 Identity = 21/36 (58.33%), Postives = 26/36 (72.22%), Query Frame = -3
BLAST of WMU68234 vs. NCBI nr
Match: gi|449432002|ref|XP_004133789.1| (PREDICTED: 3-ketoacyl-CoA synthase 1 [Cucumis sativus]) HSP 1 Score: 147.1 bits (370), Expect = 2.1e-32 Identity = 68/68 (100.00%), Postives = 68/68 (100.00%), Query Frame = -2
BLAST of WMU68234 vs. NCBI nr
Match: gi|659074853|ref|XP_008437832.1| (PREDICTED: 3-ketoacyl-CoA synthase 1 [Cucumis melo]) HSP 1 Score: 147.1 bits (370), Expect = 2.1e-32 Identity = 68/68 (100.00%), Postives = 68/68 (100.00%), Query Frame = -2
BLAST of WMU68234 vs. NCBI nr
Match: gi|1009142937|ref|XP_015888993.1| (PREDICTED: 3-ketoacyl-CoA synthase 1 [Ziziphus jujuba]) HSP 1 Score: 141.7 bits (356), Expect = 8.8e-31 Identity = 70/93 (75.27%), Postives = 76/93 (81.72%), Query Frame = -2
BLAST of WMU68234 vs. NCBI nr
Match: gi|703114496|ref|XP_010100669.1| (3-ketoacyl-CoA synthase 1 [Morus notabilis]) HSP 1 Score: 139.8 bits (351), Expect = 3.3e-30 Identity = 69/94 (73.40%), Postives = 74/94 (78.72%), Query Frame = -2
BLAST of WMU68234 vs. NCBI nr
Match: gi|357512625|ref|XP_003626601.1| (3-ketoacyl-CoA synthase-like protein [Medicago truncatula]) HSP 1 Score: 139.0 bits (349), Expect = 5.7e-30 Identity = 64/68 (94.12%), Postives = 65/68 (95.59%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|