WMU67720 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATGGCCAGACTCACATTATGGTTTACATTGGTGTATGTTCCCTTGTAGGATCTTTGTTCGGTTATGAGTGTGAAAGCAATAGGAATTGCCTTGAAGCTAACGTTATCAGGAATGAACTAGCTAATATATCCTCAAACCTGGATATTTACTTTTAGTCGTGATTACTTGTGTGCTTACCCACGATGAATTATTT
BLAST of WMU67720 vs. TAIR10
Match: AT1G34470.1 (AT1G34470.1 Protein of unknown function (DUF803)) HSP 1 Score: 57.8 bits (138), Expect = 2.9e-09 Identity = 27/31 (87.10%), Postives = 27/31 (87.10%), Query Frame = 1
HSP 2 Score: 38.5 bits (88), Expect = 1.8e-03 Identity = 16/18 (88.89%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. TAIR10
Match: AT1G71900.1 (AT1G71900.1 Protein of unknown function (DUF803)) HSP 1 Score: 54.7 bits (130), Expect = 2.5e-08 Identity = 29/44 (65.91%), Postives = 31/44 (70.45%), Query Frame = 1
HSP 2 Score: 37.0 bits (84), Expect = 5.2e-03 Identity = 15/18 (83.33%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. TAIR10
Match: AT4G09640.1 (AT4G09640.1 Protein of unknown function (DUF803)) HSP 1 Score: 52.4 bits (124), Expect = 1.2e-07 Identity = 25/31 (80.65%), Postives = 25/31 (80.65%), Query Frame = 1
HSP 2 Score: 38.1 bits (87), Expect = 2.3e-03 Identity = 15/18 (83.33%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. TAIR10
Match: AT2G21120.1 (AT2G21120.1 Protein of unknown function (DUF803)) HSP 1 Score: 47.0 bits (110), Expect = 5.1e-06 Identity = 23/43 (53.49%), Postives = 31/43 (72.09%), Query Frame = 1
HSP 2 Score: 33.9 bits (76), Expect = 4.4e-02 Identity = 13/18 (72.22%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. TAIR10
Match: AT4G38730.1 (AT4G38730.1 Protein of unknown function (DUF803)) HSP 1 Score: 46.2 bits (108), Expect = 8.7e-06 Identity = 22/43 (51.16%), Postives = 29/43 (67.44%), Query Frame = 1
HSP 2 Score: 35.0 bits (79), Expect = 2.0e-02 Identity = 14/18 (77.78%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. Swiss-Prot
Match: NIPA3_ARATH (Probable magnesium transporter NIPA3 OS=Arabidopsis thaliana GN=At1g34470 PE=2 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 5.1e-08 Identity = 27/31 (87.10%), Postives = 27/31 (87.10%), Query Frame = 1
HSP 2 Score: 38.5 bits (88), Expect = 3.2e-02 Identity = 16/18 (88.89%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. Swiss-Prot
Match: NIPA4_ARATH (Probable magnesium transporter NIPA4 OS=Arabidopsis thaliana GN=At1g71900 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 4.4e-07 Identity = 29/44 (65.91%), Postives = 31/44 (70.45%), Query Frame = 1
HSP 2 Score: 37.0 bits (84), Expect = 9.3e-02 Identity = 15/18 (83.33%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. Swiss-Prot
Match: NIPA5_ARATH (Probable magnesium transporter NIPA5 OS=Arabidopsis thaliana GN=At4g09640 PE=2 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 2.2e-06 Identity = 25/31 (80.65%), Postives = 25/31 (80.65%), Query Frame = 1
HSP 2 Score: 38.1 bits (87), Expect = 4.2e-02 Identity = 15/18 (83.33%), Postives = 16/18 (88.89%), Query Frame = 3
BLAST of WMU67720 vs. NCBI nr
Match: gi|778680310|ref|XP_011651286.1| (PREDICTED: probable magnesium transporter NIPA4 [Cucumis sativus]) HSP 1 Score: 60.8 bits (146), Expect = 9.7e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 1
BLAST of WMU67720 vs. NCBI nr
Match: gi|659112048|ref|XP_008456039.1| (PREDICTED: magnesium transporter NIPA2-like isoform X1 [Cucumis melo]) HSP 1 Score: 60.8 bits (146), Expect = 9.7e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 1
BLAST of WMU67720 vs. NCBI nr
Match: gi|659112050|ref|XP_008456040.1| (PREDICTED: magnesium transporter NIPA2-like isoform X2 [Cucumis melo]) HSP 1 Score: 60.8 bits (146), Expect = 9.7e-07 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 1
BLAST of WMU67720 vs. NCBI nr
Match: gi|527208132|gb|EPS73206.1| (hypothetical protein M569_01549, partial [Genlisea aurea]) HSP 1 Score: 60.5 bits (145), Expect = 1.3e-06 Identity = 30/44 (68.18%), Postives = 34/44 (77.27%), Query Frame = 1
BLAST of WMU67720 vs. NCBI nr
Match: gi|645223680|ref|XP_008218748.1| (PREDICTED: magnesium transporter NIPA2-like [Prunus mume]) HSP 1 Score: 59.3 bits (142), Expect = 2.8e-06 Identity = 27/31 (87.10%), Postives = 30/31 (96.77%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|