WMU66990 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAGGACGAAGGAGACACCACCCACATTTCGACTGAGACAATCGACAGGCTGAGGAAGAAGATTTACGAGTATCTTCTCATGCACGTCGAGTCTGCAGCTGCTGCACTCGGGG
BLAST of WMU66990 vs. TAIR10
Match: AT1G08760.1 (AT1G08760.1 Plant protein of unknown function (DUF936)) HSP 1 Score: 56.2 bits (134), Expect = 4.9e-09 Identity = 28/37 (75.68%), Postives = 28/37 (75.68%), Query Frame = 1
BLAST of WMU66990 vs. NCBI nr
Match: gi|700191103|gb|KGN46307.1| (hypothetical protein Csa_6G081480 [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 2.2e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of WMU66990 vs. NCBI nr
Match: gi|449454584|ref|XP_004145034.1| (PREDICTED: uncharacterized protein LOC101214568 [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 2.2e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of WMU66990 vs. NCBI nr
Match: gi|659120138|ref|XP_008460033.1| (PREDICTED: probable GPI-anchored adhesin-like protein PGA55 [Cucumis melo]) HSP 1 Score: 73.2 bits (178), Expect = 1.1e-10 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of WMU66990 vs. NCBI nr
Match: gi|731391107|ref|XP_010650628.1| (PREDICTED: uncharacterized protein LOC104879471 [Vitis vinifera]) HSP 1 Score: 68.9 bits (167), Expect = 2.1e-09 Identity = 34/37 (91.89%), Postives = 34/37 (91.89%), Query Frame = 1
BLAST of WMU66990 vs. NCBI nr
Match: gi|743926479|ref|XP_011007404.1| (PREDICTED: uncharacterized protein LOC105113084 [Populus euphratica]) HSP 1 Score: 65.1 bits (157), Expect = 3.0e-08 Identity = 31/37 (83.78%), Postives = 34/37 (91.89%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|