WMU66812 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTATGGCCGAACATATTCGAAACAATCACCACACGTCATAAACGCTGTGATGGAAGCCATTGAAGGAATGAGGGTGGCATTGGGTGCAGCTAAGTTGTGCTCAACTACTGCCTGCAGGGGCTTTTTCACCCCGCTCGGAAAAGTACGAGAAGTATACTGGAAAATCTACAACTCACTGTACATTGGTGCTCAGGATGCTCTCGTTGCATCTTATCCTGCATTAGAGGATGGAGAAAACATGTGTACAGCCGACCGGAACTGGTGATTGTTTATCTGAAGTTTCTTCAATTTTGTTGCAAATGAGAGGCGATAGATGATAGGCCTCTGAATTCTTGTTGAAGAGTATGTATTGAATTTAGTTGATT
BLAST of WMU66812 vs. TAIR10
Match: AT5G64270.1 (AT5G64270.1 splicing factor, putative) HSP 1 Score: 103.6 bits (257), Expect = 8.7e-23 Identity = 53/71 (74.65%), Postives = 56/71 (78.87%), Query Frame = 2
HSP 2 Score: 47.8 bits (112), Expect = 5.7e-06 Identity = 34/96 (35.42%), Postives = 50/96 (52.08%), Query Frame = 1
BLAST of WMU66812 vs. Swiss-Prot
Match: SF3B1_XENLA (Splicing factor 3B subunit 1 OS=Xenopus laevis GN=sf3b1 PE=2 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 9.7e-16 Identity = 40/70 (57.14%), Postives = 50/70 (71.43%), Query Frame = 2
HSP 2 Score: 38.9 bits (89), Expect = 4.7e-02 Identity = 23/47 (48.94%), Postives = 25/47 (53.19%), Query Frame = 1
BLAST of WMU66812 vs. Swiss-Prot
Match: SF3B1_HUMAN (Splicing factor 3B subunit 1 OS=Homo sapiens GN=SF3B1 PE=1 SV=3) HSP 1 Score: 83.2 bits (204), Expect = 2.2e-15 Identity = 39/66 (59.09%), Postives = 48/66 (72.73%), Query Frame = 2
HSP 2 Score: 40.0 bits (92), Expect = 2.1e-02 Identity = 24/48 (50.00%), Postives = 26/48 (54.17%), Query Frame = 1
BLAST of WMU66812 vs. Swiss-Prot
Match: SF3B1_MOUSE (Splicing factor 3B subunit 1 OS=Mus musculus GN=Sf3b1 PE=1 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.2e-15 Identity = 39/66 (59.09%), Postives = 48/66 (72.73%), Query Frame = 2
HSP 2 Score: 40.0 bits (92), Expect = 2.1e-02 Identity = 24/48 (50.00%), Postives = 26/48 (54.17%), Query Frame = 1
BLAST of WMU66812 vs. Swiss-Prot
Match: SF3B1_SCHPO (U2 snRNP component prp10 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=prp10 PE=1 SV=3) HSP 1 Score: 65.9 bits (159), Expect = 3.6e-10 Identity = 31/72 (43.06%), Postives = 43/72 (59.72%), Query Frame = 2
BLAST of WMU66812 vs. NCBI nr
Match: gi|449438767|ref|XP_004137159.1| (PREDICTED: splicing factor 3B subunit 1 [Cucumis sativus]) HSP 1 Score: 114.0 bits (284), Expect = 1.8e-22 Identity = 58/71 (81.69%), Postives = 61/71 (85.92%), Query Frame = 2
BLAST of WMU66812 vs. NCBI nr
Match: gi|659125826|ref|XP_008462876.1| (PREDICTED: splicing factor 3B subunit 1 [Cucumis melo]) HSP 1 Score: 114.0 bits (284), Expect = 1.8e-22 Identity = 58/71 (81.69%), Postives = 61/71 (85.92%), Query Frame = 2
BLAST of WMU66812 vs. NCBI nr
Match: gi|947072375|gb|KRH21266.1| (hypothetical protein GLYMA_13G2292001, partial [Glycine max]) HSP 1 Score: 109.8 bits (273), Expect = 3.4e-21 Identity = 56/71 (78.87%), Postives = 60/71 (84.51%), Query Frame = 2
BLAST of WMU66812 vs. NCBI nr
Match: gi|356546579|ref|XP_003541702.1| (PREDICTED: splicing factor 3B subunit 1 [Glycine max]) HSP 1 Score: 109.8 bits (273), Expect = 3.4e-21 Identity = 56/71 (78.87%), Postives = 60/71 (84.51%), Query Frame = 2
BLAST of WMU66812 vs. NCBI nr
Match: gi|971587292|ref|XP_015161052.1| (PREDICTED: LOW QUALITY PROTEIN: splicing factor 3B subunit 1-like [Solanum tuberosum]) HSP 1 Score: 109.4 bits (272), Expect = 4.5e-21 Identity = 56/71 (78.87%), Postives = 59/71 (83.10%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|