WMU66035 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AACTCCGAAGCAGAGTGGGTGGCAACCAAATGAAGCAAGAAGAAGTGAATCGGTGCCAAATTCAAGAATGGTATCCAGAATTCAAATCCTTCTCTATCAAAACCCT
BLAST of WMU66035 vs. TAIR10
Match: AT4G05440.1 (AT4G05440.1 temperature sensing protein-related) HSP 1 Score: 47.8 bits (112), Expect = 1.6e-06 Identity = 19/25 (76.00%), Postives = 20/25 (80.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|