|
|
The following sequences are available for this feature:
transcribed_cluster sequence CCAAACTGATTACAAGGAATGCCAGAATTTCCAAACCGTGTTCTTTGTATTTGTTCGTATAGTTGGTTCAACTCCAGATAGTTTGAATTTGTTCATCCCACCATTTGGTAAGGCAACGTCGACAATG
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
This transcribed_cluster is associated with the following gene feature(s):
| Feature Name | Unique Name | Type |
|---|
| Cla011456 | Cla011456 | gene |
The following EST feature(s) are a part of this transcribed_cluster:
| Feature Name | Unique Name | Type |
|---|
| S2_0089835 | S2_0089835 | EST |
|
