WMU63230 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTATAGGTCAGACACCCACTTGGGAATTGGGTCGGGTCGGGCCAGTAGGGCTTCGATCCAGGAAATGGAGAGAATTGAAATTGATGGGGTTTGGGTTGATTGTGTGATCTGTTTGGATGAGATTGATCCAATTGGGTATGAAATTGATGCTGTTCGAATGTCTTGTTTACATGTTTATCATCGAAATTGTATTCACAAATGGCTAGAACTCAGTAATCGTTGCCCTCTGTGTCGGTTTCAGATGCCATTGGAAGAAGAATGATGCTCTGTTTTTCTTCTCGTTCGATTCTGTAATATATTTTACTTTTCTTTATTGGGGTTTTTTCTTTTTTTTTCGTTTAGG
BLAST of WMU63230 vs. TAIR10
Match: AT1G26800.1 (AT1G26800.1 RING/U-box superfamily protein) HSP 1 Score: 67.8 bits (164), Expect = 5.0e-12 Identity = 33/75 (44.00%), Postives = 41/75 (54.67%), Query Frame = 2
BLAST of WMU63230 vs. TAIR10
Match: AT5G59550.1 (AT5G59550.1 zinc finger (C3HC4-type RING finger) family protein) HSP 1 Score: 62.4 bits (150), Expect = 2.1e-10 Identity = 28/79 (35.44%), Postives = 45/79 (56.96%), Query Frame = 2
BLAST of WMU63230 vs. TAIR10
Match: AT3G19950.1 (AT3G19950.1 RING/U-box superfamily protein) HSP 1 Score: 61.2 bits (147), Expect = 4.7e-10 Identity = 26/81 (32.10%), Postives = 46/81 (56.79%), Query Frame = 2
BLAST of WMU63230 vs. TAIR10
Match: AT3G14970.1 (AT3G14970.1 RING/U-box superfamily protein) HSP 1 Score: 58.2 bits (139), Expect = 4.0e-09 Identity = 29/70 (41.43%), Postives = 39/70 (55.71%), Query Frame = 2
BLAST of WMU63230 vs. TAIR10
Match: AT3G46620.1 (AT3G46620.1 zinc finger (C3HC4-type RING finger) family protein) HSP 1 Score: 58.2 bits (139), Expect = 4.0e-09 Identity = 25/77 (32.47%), Postives = 42/77 (54.55%), Query Frame = 2
BLAST of WMU63230 vs. Swiss-Prot
Match: RDUF2_ARATH (E3 ubiquitin-protein ligase RDUF2 OS=Arabidopsis thaliana GN=DURF2 PE=1 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 3.7e-09 Identity = 28/79 (35.44%), Postives = 45/79 (56.96%), Query Frame = 2
BLAST of WMU63230 vs. Swiss-Prot
Match: RNG1L_ARATH (E3 ubiquitin-protein ligase RING1-like OS=Arabidopsis thaliana GN=At3g19950 PE=1 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 8.3e-09 Identity = 26/81 (32.10%), Postives = 46/81 (56.79%), Query Frame = 2
BLAST of WMU63230 vs. Swiss-Prot
Match: RING1_GOSHI (E3 ubiquitin-protein ligase RING1 OS=Gossypium hirsutum GN=RING1 PE=1 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.8e-08 Identity = 25/81 (30.86%), Postives = 47/81 (58.02%), Query Frame = 2
BLAST of WMU63230 vs. Swiss-Prot
Match: RN181_BOVIN (E3 ubiquitin-protein ligase RNF181 OS=Bos taurus GN=RNF181 PE=2 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 5.4e-08 Identity = 26/75 (34.67%), Postives = 42/75 (56.00%), Query Frame = 2
BLAST of WMU63230 vs. Swiss-Prot
Match: RDUF1_ARATH (E3 ubiquitin-protein ligase RDUF1 OS=Arabidopsis thaliana GN=RDUF1 PE=1 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 7.0e-08 Identity = 25/77 (32.47%), Postives = 42/77 (54.55%), Query Frame = 2
BLAST of WMU63230 vs. NCBI nr
Match: gi|659067058|ref|XP_008437461.1| (PREDICTED: uncharacterized protein LOC103482872 [Cucumis melo]) HSP 1 Score: 160.6 bits (405), Expect = 1.6e-36 Identity = 75/86 (87.21%), Postives = 77/86 (89.53%), Query Frame = 2
BLAST of WMU63230 vs. NCBI nr
Match: gi|449469653|ref|XP_004152533.1| (PREDICTED: LON peptidase N-terminal domain and RING finger protein 2-like [Cucumis sativus]) HSP 1 Score: 157.5 bits (397), Expect = 1.4e-35 Identity = 73/86 (84.88%), Postives = 76/86 (88.37%), Query Frame = 2
BLAST of WMU63230 vs. NCBI nr
Match: gi|645269135|ref|XP_008239859.1| (PREDICTED: E3 ubiquitin-protein ligase At3g02290-like [Prunus mume]) HSP 1 Score: 83.2 bits (204), Expect = 3.3e-13 Identity = 37/74 (50.00%), Postives = 52/74 (70.27%), Query Frame = 2
BLAST of WMU63230 vs. NCBI nr
Match: gi|595851940|ref|XP_007210215.1| (hypothetical protein PRUPE_ppa016054mg, partial [Prunus persica]) HSP 1 Score: 81.6 bits (200), Expect = 9.5e-13 Identity = 36/72 (50.00%), Postives = 50/72 (69.44%), Query Frame = 2
BLAST of WMU63230 vs. NCBI nr
Match: gi|702281757|ref|XP_010045575.1| (PREDICTED: uncharacterized protein LOC104434326 [Eucalyptus grandis]) HSP 1 Score: 81.3 bits (199), Expect = 1.2e-12 Identity = 42/75 (56.00%), Postives = 52/75 (69.33%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|