WMU63224 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATTGATAGACGCTTTCAGAATCCTCTTGTCTTCAAGCTCAAATACATAAGTGTTATATCCAAGAGTGCATTTTGGTGTATGGGTAAAATAATATGCAACTCCCTTTAAG
BLAST of WMU63224 vs. NCBI nr
Match: gi|659081066|ref|XP_008441132.1| (PREDICTED: F-box protein At2g17036 [Cucumis melo]) HSP 1 Score: 65.1 bits (157), Expect = 2.9e-08 Identity = 29/34 (85.29%), Postives = 30/34 (88.24%), Query Frame = -2
BLAST of WMU63224 vs. NCBI nr
Match: gi|778719846|ref|XP_004134837.2| (PREDICTED: putative F-box protein At1g65770 [Cucumis sativus]) HSP 1 Score: 58.5 bits (140), Expect = 2.7e-06 Identity = 26/33 (78.79%), Postives = 27/33 (81.82%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|