WMU63146 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGCGCCAAGTTGCGGCAGAGAAGGCGGTGGCTGACGGTGGGTCCTCTCACCGAAATATCAAACACTTTATTGATGAGATTAGGAAACGGTCTCTTGGATGTGGTGGAAATCTCCAAGTTTGTCCCCTCTACTACCTAGAAAATCATAATCATCATCATTTTTT
BLAST of WMU63146 vs. NCBI nr
Match: gi|659109996|ref|XP_008454993.1| (PREDICTED: putative UDP-glucose glucosyltransferase [Cucumis melo]) HSP 1 Score: 75.1 bits (183), Expect = 4.1e-11 Identity = 35/40 (87.50%), Postives = 38/40 (95.00%), Query Frame = 3
BLAST of WMU63146 vs. NCBI nr
Match: gi|778725001|ref|XP_004137100.2| (PREDICTED: limonoid UDP-glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 32/39 (82.05%), Postives = 35/39 (89.74%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|