WMU62876 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAATCCCAAGGTGCACAAACAGTAAAGAACTTTCCCAATGCTTCACTCACTTGCCATTAAGCCTCTCAATAACAGAGATTAAGCCTTGACTGCCCAATTTTCCATCTCCATTAGCCACCATTGCAGAGAAAAATTGCTTGGTCAATGCAGCCCCTGGCAAACACTACAATCCTCTCATCTTCCCCTTCTTCCACAACATCCACAGCCATTCCTAAAATCCTTCACCATATACTCAGCGAACC
BLAST of WMU62876 vs. TAIR10
Match: AT1G71180.1 (AT1G71180.1 6-phosphogluconate dehydrogenase family protein) HSP 1 Score: 59.7 bits (143), Expect = 9.5e-10 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = -2
BLAST of WMU62876 vs. TAIR10
Match: AT1G71170.1 (AT1G71170.1 6-phosphogluconate dehydrogenase family protein) HSP 1 Score: 56.2 bits (134), Expect = 1.1e-08 Identity = 25/36 (69.44%), Postives = 27/36 (75.00%), Query Frame = -2
BLAST of WMU62876 vs. Swiss-Prot
Match: 3HID3_ARATH (Probable 3-hydroxyisobutyrate dehydrogenase-like 3, mitochondrial OS=Arabidopsis thaliana GN=At1g71180 PE=2 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.7e-08 Identity = 27/36 (75.00%), Postives = 30/36 (83.33%), Query Frame = -2
BLAST of WMU62876 vs. Swiss-Prot
Match: 3HID2_ARATH (Probable 3-hydroxyisobutyrate dehydrogenase-like 2, mitochondrial OS=Arabidopsis thaliana GN=At1g71170 PE=2 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 1.9e-07 Identity = 25/36 (69.44%), Postives = 27/36 (75.00%), Query Frame = -2
BLAST of WMU62876 vs. NCBI nr
Match: gi|778680236|ref|XP_004149969.2| (PREDICTED: probable 3-hydroxyisobutyrate dehydrogenase-like 3, mitochondrial [Cucumis sativus]) HSP 1 Score: 71.2 bits (173), Expect = 9.0e-10 Identity = 34/37 (91.89%), Postives = 35/37 (94.59%), Query Frame = -2
BLAST of WMU62876 vs. NCBI nr
Match: gi|659112135|ref|XP_008456080.1| (PREDICTED: probable 3-hydroxyisobutyrate dehydrogenase-like 3, mitochondrial [Cucumis melo]) HSP 1 Score: 70.1 bits (170), Expect = 2.0e-09 Identity = 34/37 (91.89%), Postives = 34/37 (91.89%), Query Frame = -2
BLAST of WMU62876 vs. NCBI nr
Match: gi|698425322|ref|XP_009785096.1| (PREDICTED: probable 3-hydroxyisobutyrate dehydrogenase-like 2, mitochondrial [Nicotiana sylvestris]) HSP 1 Score: 69.3 bits (168), Expect = 3.4e-09 Identity = 32/37 (86.49%), Postives = 36/37 (97.30%), Query Frame = -2
BLAST of WMU62876 vs. NCBI nr
Match: gi|969996808|ref|XP_015064791.1| (PREDICTED: probable 3-hydroxyisobutyrate dehydrogenase-like 2, mitochondrial [Solanum pennellii]) HSP 1 Score: 68.9 bits (167), Expect = 4.5e-09 Identity = 32/37 (86.49%), Postives = 35/37 (94.59%), Query Frame = -2
BLAST of WMU62876 vs. NCBI nr
Match: gi|641834464|gb|KDO53457.1| (hypothetical protein CISIN_1g0362642mg, partial [Citrus sinensis]) HSP 1 Score: 68.9 bits (167), Expect = 4.5e-09 Identity = 32/37 (86.49%), Postives = 35/37 (94.59%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|