WMU62482 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGGGGCCATGAAAAGGGGCTGACGGTGGTGGTGGATAATACTTTTGCCCCCATGGTTCTGTCGCCGGCGAGACTCGGTGCTGACGTCGTCGTTCATAGTATTTCTAAGTTCATTAGCGGTGGAGCTGACATCATTGCAGGTAACTTTTTTCTTACAC
BLAST of WMU62482 vs. TAIR10
Match: AT1G64660.1 (AT1G64660.1 methionine gamma-lyase) HSP 1 Score: 88.2 bits (217), Expect = 1.6e-18 Identity = 43/45 (95.56%), Postives = 43/45 (95.56%), Query Frame = 1
BLAST of WMU62482 vs. TAIR10
Match: AT3G57050.1 (AT3G57050.1 cystathionine beta-lyase) HSP 1 Score: 49.7 bits (117), Expect = 6.4e-07 Identity = 24/46 (52.17%), Postives = 32/46 (69.57%), Query Frame = 1
BLAST of WMU62482 vs. TAIR10
Match: AT3G01120.1 (AT3G01120.1 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein) HSP 1 Score: 45.8 bits (107), Expect = 9.3e-06 Identity = 22/46 (47.83%), Postives = 29/46 (63.04%), Query Frame = 1
BLAST of WMU62482 vs. Swiss-Prot
Match: MGL_ARATH (Methionine gamma-lyase OS=Arabidopsis thaliana GN=MGL PE=1 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 2.9e-17 Identity = 43/45 (95.56%), Postives = 43/45 (95.56%), Query Frame = 1
BLAST of WMU62482 vs. Swiss-Prot
Match: MEGL_FUSNP (L-methionine gamma-lyase OS=Fusobacterium nucleatum subsp. polymorphum GN=mgl PE=1 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.0e-06 Identity = 24/40 (60.00%), Postives = 31/40 (77.50%), Query Frame = 1
BLAST of WMU62482 vs. Swiss-Prot
Match: CGL_DICDI (Cystathionine gamma-lyase OS=Dictyostelium discoideum GN=cysA PE=1 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 1.8e-06 Identity = 23/46 (50.00%), Postives = 33/46 (71.74%), Query Frame = 1
BLAST of WMU62482 vs. Swiss-Prot
Match: METB_MYCBO (Cystathionine gamma-synthase OS=Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97) GN=metB PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 3.0e-06 Identity = 24/47 (51.06%), Postives = 32/47 (68.09%), Query Frame = 1
BLAST of WMU62482 vs. Swiss-Prot
Match: METB_MYCTO (Cystathionine gamma-synthase OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) GN=metB PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 3.0e-06 Identity = 24/47 (51.06%), Postives = 32/47 (68.09%), Query Frame = 1
BLAST of WMU62482 vs. NCBI nr
Match: gi|449456795|ref|XP_004146134.1| (PREDICTED: methionine gamma-lyase-like [Cucumis sativus]) HSP 1 Score: 91.3 bits (225), Expect = 5.5e-16 Identity = 44/46 (95.65%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU62482 vs. NCBI nr
Match: gi|307136088|gb|ADN33936.1| (cystathionine gamma-synthase [Cucumis melo subsp. melo]) HSP 1 Score: 91.3 bits (225), Expect = 5.5e-16 Identity = 44/46 (95.65%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU62482 vs. NCBI nr
Match: gi|659095405|ref|XP_008448562.1| (PREDICTED: methionine gamma-lyase-like [Cucumis melo]) HSP 1 Score: 91.3 bits (225), Expect = 5.5e-16 Identity = 44/46 (95.65%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU62482 vs. NCBI nr
Match: gi|451811145|gb|AGF70153.1| (methionine gamma-lyase [Cucumis melo]) HSP 1 Score: 91.3 bits (225), Expect = 5.5e-16 Identity = 44/46 (95.65%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU62482 vs. NCBI nr
Match: gi|727653358|ref|XP_010497416.1| (PREDICTED: methionine gamma-lyase-like [Camelina sativa]) HSP 1 Score: 90.5 bits (223), Expect = 9.3e-16 Identity = 44/46 (95.65%), Postives = 46/46 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|