WMU62172 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GATCGTCCTCAGCACTTCTAGGGTTTCTTTCCTCGCCTCCTCTCTCTCTTCCTCTCCCGCCGTAAAAATCCTCCTAATCGTCGCTTCCTATAGAAAAATCAAAGGATCCAAAAATGTCCTCGGATCTAAACAGAGCAGAATTAGAATATGAAAACGATTGCCTTACCTTATCCTCAATGAATTTGATCCAGAAGCGAGCGGTGGCTCTGTGGAAAGGATCGGACGGTAGCAGAGGTTTTTCCGGCCAAGTGTCGTCGATGTACTCGAGGATGACGGCGGATTCGCAGATAGGGTTTCCGGCATGGACGAGCACCGGAATCTTCTTGTGGACGGGATTGTAATGAAGGAGCAAAAGGGGGTTTTGTTGGCCATGTGTTCTTGAATAAAATGGTAGGGTATGCGTTTGAGTTGCAGAGCCCATATCACTCTGTAGCTGAAAGGACTTGCCCAACTTCCATGGACCTTCACTTCTTCTTCCATCCTCAAATTCAACTAAATCTTCC
BLAST of WMU62172 vs. TAIR10
Match: AT1G17180.1 (AT1G17180.1 glutathione S-transferase TAU 25) HSP 1 Score: 95.9 bits (237), Expect = 2.5e-20 Identity = 43/67 (64.18%), Postives = 50/67 (74.63%), Query Frame = -2
BLAST of WMU62172 vs. TAIR10
Match: AT1G17170.1 (AT1G17170.1 glutathione S-transferase TAU 24) HSP 1 Score: 95.1 bits (235), Expect = 4.3e-20 Identity = 42/64 (65.62%), Postives = 49/64 (76.56%), Query Frame = -2
BLAST of WMU62172 vs. TAIR10
Match: AT2G29420.1 (AT2G29420.1 glutathione S-transferase tau 7) HSP 1 Score: 93.6 bits (231), Expect = 1.2e-19 Identity = 40/63 (63.49%), Postives = 47/63 (74.60%), Query Frame = -2
HSP 2 Score: 45.1 bits (105), Expect = 5.1e-05 Identity = 20/39 (51.28%), Postives = 26/39 (66.67%), Query Frame = -3
BLAST of WMU62172 vs. TAIR10
Match: AT1G78340.1 (AT1G78340.1 glutathione S-transferase TAU 22) HSP 1 Score: 91.7 bits (226), Expect = 4.7e-19 Identity = 38/64 (59.38%), Postives = 49/64 (76.56%), Query Frame = -2
BLAST of WMU62172 vs. TAIR10
Match: AT1G78370.1 (AT1G78370.1 glutathione S-transferase TAU 20) HSP 1 Score: 90.1 bits (222), Expect = 1.4e-18 Identity = 38/63 (60.32%), Postives = 46/63 (73.02%), Query Frame = -2
BLAST of WMU62172 vs. Swiss-Prot
Match: GSTX6_SOYBN (Probable glutathione S-transferase OS=Glycine max GN=HSP26-A PE=2 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 4.0e-20 Identity = 45/70 (64.29%), Postives = 51/70 (72.86%), Query Frame = -2
HSP 2 Score: 38.1 bits (87), Expect = 1.1e-01 Identity = 18/40 (45.00%), Postives = 26/40 (65.00%), Query Frame = -3
BLAST of WMU62172 vs. Swiss-Prot
Match: GSTUP_ARATH (Glutathione S-transferase U25 OS=Arabidopsis thaliana GN=GSTU25 PE=1 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 4.5e-19 Identity = 43/67 (64.18%), Postives = 50/67 (74.63%), Query Frame = -2
BLAST of WMU62172 vs. Swiss-Prot
Match: GSTUO_ARATH (Glutathione S-transferase U24 OS=Arabidopsis thaliana GN=GSTU24 PE=2 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 7.6e-19 Identity = 42/64 (65.62%), Postives = 49/64 (76.56%), Query Frame = -2
BLAST of WMU62172 vs. Swiss-Prot
Match: GSTX3_SOYBN (Glutathione S-transferase 3 OS=Glycine max GN=GST3 PE=1 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 1.3e-18 Identity = 39/64 (60.94%), Postives = 52/64 (81.25%), Query Frame = -2
BLAST of WMU62172 vs. Swiss-Prot
Match: GSTX1_NICPL (Probable glutathione S-transferase MSR-1 OS=Nicotiana plumbaginifolia GN=MSR-1 PE=2 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 1.3e-18 Identity = 42/64 (65.62%), Postives = 49/64 (76.56%), Query Frame = -2
BLAST of WMU62172 vs. NCBI nr
Match: gi|659075974|ref|XP_008438431.1| (PREDICTED: probable glutathione S-transferase [Cucumis melo]) HSP 1 Score: 128.6 bits (322), Expect = 9.9e-27 Identity = 61/83 (73.49%), Postives = 67/83 (80.72%), Query Frame = -2
BLAST of WMU62172 vs. NCBI nr
Match: gi|23978432|dbj|BAC21263.1| (glutathione S-transferase [Cucurbita maxima]) HSP 1 Score: 127.5 bits (319), Expect = 2.2e-26 Identity = 56/62 (90.32%), Postives = 58/62 (93.55%), Query Frame = -2
BLAST of WMU62172 vs. NCBI nr
Match: gi|659075962|ref|XP_008438425.1| (PREDICTED: probable glutathione S-transferase [Cucumis melo]) HSP 1 Score: 121.3 bits (303), Expect = 1.6e-24 Identity = 52/62 (83.87%), Postives = 58/62 (93.55%), Query Frame = -2
BLAST of WMU62172 vs. NCBI nr
Match: gi|659075966|ref|XP_008438427.1| (PREDICTED: probable glutathione S-transferase isoform X2 [Cucumis melo]) HSP 1 Score: 118.6 bits (296), Expect = 1.0e-23 Identity = 52/62 (83.87%), Postives = 55/62 (88.71%), Query Frame = -2
BLAST of WMU62172 vs. NCBI nr
Match: gi|255554288|ref|XP_002518184.1| (PREDICTED: probable glutathione S-transferase [Ricinus communis]) HSP 1 Score: 117.1 bits (292), Expect = 3.0e-23 Identity = 50/62 (80.65%), Postives = 54/62 (87.10%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|