WMU62163 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AATTTGAAGCTTCCCTTCTATCCTCTCGCCTTTTCTTGGAGTGTATACCAGATTATGGATATCATCAGCCAATGCTCTCTGGGCTAAAACAGCCCCACCAGCAGCAC
BLAST of WMU62163 vs. TAIR10
Match: AT3G22450.1 (AT3G22450.1 Ribosomal L18p/L5e family protein) HSP 1 Score: 58.9 bits (141), Expect = 7.1e-10 Identity = 26/35 (74.29%), Postives = 31/35 (88.57%), Query Frame = -3
BLAST of WMU62163 vs. NCBI nr
Match: gi|659118877|ref|XP_008459355.1| (PREDICTED: uncharacterized protein LOC103498514 [Cucumis melo]) HSP 1 Score: 68.2 bits (165), Expect = 3.3e-09 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = -3
BLAST of WMU62163 vs. NCBI nr
Match: gi|778707360|ref|XP_011656005.1| (PREDICTED: uncharacterized protein LOC101213193 [Cucumis sativus]) HSP 1 Score: 67.0 bits (162), Expect = 7.4e-09 Identity = 32/35 (91.43%), Postives = 33/35 (94.29%), Query Frame = -3
BLAST of WMU62163 vs. NCBI nr
Match: gi|356540329|ref|XP_003538642.1| (PREDICTED: uncharacterized protein LOC100802391 [Glycine max]) HSP 1 Score: 65.5 bits (158), Expect = 2.2e-08 Identity = 30/35 (85.71%), Postives = 34/35 (97.14%), Query Frame = -3
BLAST of WMU62163 vs. NCBI nr
Match: gi|695022618|ref|XP_009398445.1| (PREDICTED: uncharacterized protein LOC103983032 [Musa acuminata subsp. malaccensis]) HSP 1 Score: 64.3 bits (155), Expect = 4.8e-08 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = -3
BLAST of WMU62163 vs. NCBI nr
Match: gi|1012350600|gb|KYP61789.1| (hypothetical protein KK1_016300 [Cajanus cajan]) HSP 1 Score: 64.3 bits (155), Expect = 4.8e-08 Identity = 29/35 (82.86%), Postives = 34/35 (97.14%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|