WMU62080 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTGAGCATCACCTAGCCGTGAAGCTGCTGTTGCCATAAGCTGGAGGGACAGAGGCCAAACCAGGACAATCCCTAGCCCAATGCCCAGTTTTGATGGCATTTGAAGCATTCACCAGAGGCACCACCAGAAGGACCAGAAGCTCTATTTGAATACATCCCCCCACCA
BLAST of WMU62080 vs. NCBI nr
Match: gi|659095462|ref|XP_008448593.1| (PREDICTED: replication protein A 70 kDa DNA-binding subunit A [Cucumis melo]) HSP 1 Score: 57.8 bits (138), Expect = 6.9e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = -3
BLAST of WMU62080 vs. NCBI nr
Match: gi|449456771|ref|XP_004146122.1| (PREDICTED: replication protein A 70 kDa DNA-binding subunit A [Cucumis sativus]) HSP 1 Score: 57.8 bits (138), Expect = 6.9e-06 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|