WMU61400 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCATTCTAAGAAAGAATCTTTTGACATTCGATAAAAGGGATGACACAGCCAATACTGCATCAATGCAGAAAGAAGCAATGCCTCTCTCAGAAATTAGTTCAAATGCAATCAATGAAATGAAAGGGCCAAATATTTTGTAGAGAGCAAAAGAATGAAATAGGAGGGCACTTGTTCATACCATCCAACATAAGAAGGAAACTGATTCACCAGCCAAAGAAGGATTTCTTTCGAAAGTACGGAAAATAGTTT
BLAST of WMU61400 vs. NCBI nr
Match: gi|659074979|ref|XP_008437898.1| (PREDICTED: uncharacterized protein LOC103483189 [Cucumis melo]) HSP 1 Score: 86.3 bits (212), Expect = 2.8e-14 Identity = 53/81 (65.43%), Postives = 59/81 (72.84%), Query Frame = 3
BLAST of WMU61400 vs. NCBI nr
Match: gi|449432046|ref|XP_004133811.1| (PREDICTED: uncharacterized protein LOC101209332 [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 3.7e-11 Identity = 49/74 (66.22%), Postives = 53/74 (71.62%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|