WMU61335 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGTTCGTAACATTCTAGACGGTGGCGTAAATTGCTCGCGGAGAATCGATCGCCATGGAAAGACCATATCGGATCTCATCTTGAACCAGCAAAATTGTTTTGCCACCATAGTCTGGTGGTTCACATAAAATCACACAGAAGAGATCTAAAATTTCTGAACCAGAAGGCTCTTCTAGGCAATAAAGTATCTTGCCTTCTGCCGTTGGATTACTTTACCTTGTAATTCTGAACTCCAACTTGTGCTTCTAATGCCTTCAAAATCTTTTGTCGGTCAAGTACGGAT
BLAST of WMU61335 vs. TAIR10
Match: AT1G01770.1 (AT1G01770.1 unknown protein) HSP 1 Score: 60.8 bits (146), Expect = 5.0e-10 Identity = 29/30 (96.67%), Postives = 27/30 (90.00%), Query Frame = 2
BLAST of WMU61335 vs. NCBI nr
Match: gi|920718120|gb|KOM57317.1| (hypothetical protein LR48_Vigan11g035000 [Vigna angularis]) HSP 1 Score: 64.3 bits (155), Expect = 1.3e-07 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU61335 vs. NCBI nr
Match: gi|449433087|ref|XP_004134329.1| (PREDICTED: uncharacterized protein LOC101212841 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.7e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 2
BLAST of WMU61335 vs. NCBI nr
Match: gi|700201399|gb|KGN56532.1| (hypothetical protein Csa_3G122560 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.7e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 2
BLAST of WMU61335 vs. NCBI nr
Match: gi|659075289|ref|XP_008438065.1| (PREDICTED: uncharacterized protein LOC103483286 [Cucumis melo]) HSP 1 Score: 63.9 bits (154), Expect = 1.7e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 2
BLAST of WMU61335 vs. NCBI nr
Match: gi|604329919|gb|EYU35076.1| (hypothetical protein MIMGU_mgv1a002868mg [Erythranthe guttata]) HSP 1 Score: 63.2 bits (152), Expect = 2.8e-07 Identity = 26/30 (86.67%), Postives = 30/30 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|