WMU61094 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTTGAAGATGCTCTTGCTCATCCTTATTTGACTTCATTGCATGACATTAGTGATGAGCCTGTCTGCATGACACCCTTCAGCTTTTGTATTTCGTAGCAGCATGCGCTTACCGAGGAACAGATG
BLAST of WMU61094 vs. TAIR10
Match: AT2G43790.1 (AT2G43790.1 MAP kinase 6) HSP 1 Score: 58.5 bits (140), Expect = 1.1e-09 Identity = 29/41 (70.73%), Postives = 29/41 (70.73%), Query Frame = 1
BLAST of WMU61094 vs. TAIR10
Match: AT3G59790.1 (AT3G59790.1 MAP kinase 10) HSP 1 Score: 52.4 bits (124), Expect = 7.8e-08 Identity = 23/40 (57.50%), Postives = 29/40 (72.50%), Query Frame = 1
BLAST of WMU61094 vs. TAIR10
Match: AT4G01370.1 (AT4G01370.1 MAP kinase 4) HSP 1 Score: 50.4 bits (119), Expect = 3.0e-07 Identity = 23/41 (56.10%), Postives = 28/41 (68.29%), Query Frame = 1
BLAST of WMU61094 vs. TAIR10
Match: AT1G01560.2 (AT1G01560.2 MAP kinase 11) HSP 1 Score: 46.6 bits (109), Expect = 4.3e-06 Identity = 21/41 (51.22%), Postives = 27/41 (65.85%), Query Frame = 1
BLAST of WMU61094 vs. TAIR10
Match: AT3G45640.1 (AT3G45640.1 mitogen-activated protein kinase 3) HSP 1 Score: 46.2 bits (108), Expect = 5.6e-06 Identity = 23/41 (56.10%), Postives = 24/41 (58.54%), Query Frame = 1
BLAST of WMU61094 vs. Swiss-Prot
Match: MMK1_MEDSA (Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa GN=MMK1 PE=1 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 2.0e-13 Identity = 37/41 (90.24%), Postives = 35/41 (85.37%), Query Frame = 1
BLAST of WMU61094 vs. Swiss-Prot
Match: NTF4_TOBAC (Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum GN=NTF4 PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 4.4e-13 Identity = 36/41 (87.80%), Postives = 35/41 (85.37%), Query Frame = 1
BLAST of WMU61094 vs. Swiss-Prot
Match: MPK_PEA (Mitogen-activated protein kinase homolog D5 OS=Pisum sativum PE=2 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 3.8e-12 Identity = 35/41 (85.37%), Postives = 34/41 (82.93%), Query Frame = 1
BLAST of WMU61094 vs. Swiss-Prot
Match: MPK1_ORYSJ (Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica GN=MPK1 PE=1 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 2.1e-10 Identity = 32/41 (78.05%), Postives = 32/41 (78.05%), Query Frame = 1
BLAST of WMU61094 vs. Swiss-Prot
Match: MPK6_ARATH (Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana GN=MPK6 PE=1 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 1.9e-08 Identity = 29/41 (70.73%), Postives = 29/41 (70.73%), Query Frame = 1
BLAST of WMU61094 vs. NCBI nr
Match: gi|7649153|gb|AAF65766.1|AF242308_1 (mitogen-activated protein kinase [Euphorbia esula]) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of WMU61094 vs. NCBI nr
Match: gi|645275921|ref|XP_008243044.1| (PREDICTED: mitogen-activated protein kinase homolog MMK1 [Prunus mume]) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of WMU61094 vs. NCBI nr
Match: gi|595804546|ref|XP_007202173.1| (hypothetical protein PRUPE_ppa006536mg [Prunus persica]) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of WMU61094 vs. NCBI nr
Match: gi|350538693|ref|NP_001234355.1| (mitogen-activated protein kinase 2 [Solanum lycopersicum]) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of WMU61094 vs. NCBI nr
Match: gi|659089394|ref|XP_008445483.1| (PREDICTED: mitogen-activated protein kinase homolog MMK1 isoform X1 [Cucumis melo]) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|