WMU60783 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTCATCAAGCATGGAGAGCCAACTTTGAGGATGAAAATACACACTCCAGCATCCAGGAATCAGATAAGAGAGAGTGACACCGAGGATGAAATGCTTAGAGCTGCTATTGAGGCTTCAAAACAGGATTCTGATCTTGAGCACTTACAAAGGCAACTTCAGCAGGAGGAGGAGGATCTTGCTCGTGCAGTTTCATTGTCGTTGAGAATGGCTGAGCAAGAGAAAGCAGTCCGTGTTTTTCAATACCATCTTCATCGACAAAGCAATCACTACAGCAACAAAAGGACACAGCAAGAAGTTTAGCTGCTCAAGAAGCTCCACACGT
BLAST of WMU60783 vs. NCBI nr
Match: gi|659075338|ref|XP_008438091.1| (PREDICTED: uncharacterized protein LOC103483304 [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 5.8e-12 Identity = 45/64 (70.31%), Postives = 47/64 (73.44%), Query Frame = 1
BLAST of WMU60783 vs. NCBI nr
Match: gi|449432187|ref|XP_004133881.1| (PREDICTED: uncharacterized protein LOC101206103 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 4.1e-10 Identity = 43/63 (68.25%), Postives = 44/63 (69.84%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|