|
The following sequences are available for this feature:
transcribed_cluster sequence TGCAACAACATGTTGATTTGAAGCTTCTTCTATTCCGTCTTGACTTCACGGAATTTTACTAGCCAATTAACGACCTCCATGTGTAGAGTGGATGTCAGATGTATATCTCACATGGCCTTTCGTTGTTAGACACAATTGGCAGAGCTCTAACAAATTTTCTATGGC
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
This transcribed_cluster is associated with the following gene feature(s):
Feature Name | Unique Name | Type |
Cla008037 | Cla008037 | gene |
The following EST feature(s) are a part of this transcribed_cluster:
Feature Name | Unique Name | Type |
S2_0017545 | S2_0017545 | EST |
|