WMU58902 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGAAGAATGGCTTATATTGTGTAGGACTATCAAGGAGAGGCCTATATGGAGCTAATTTAGATGCTCAAAATGTTGCTAAAGATATATCATCCCAAATCTATAAGTGTGGATAGAAGGAGGAAAAATAGTACTCTTCAACTAATAAAGGTAGAAATAA
BLAST of WMU58902 vs. NCBI nr
Match: gi|758742454|gb|AJO72446.1| (YUCCA type flavin monooxygenase 12 [Cucumis melo]) HSP 1 Score: 73.9 bits (180), Expect = 8.8e-11 Identity = 34/36 (94.44%), Postives = 35/36 (97.22%), Query Frame = 3
BLAST of WMU58902 vs. NCBI nr
Match: gi|659123221|ref|XP_008461553.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Cucumis melo]) HSP 1 Score: 73.9 bits (180), Expect = 8.8e-11 Identity = 34/36 (94.44%), Postives = 35/36 (97.22%), Query Frame = 3
BLAST of WMU58902 vs. NCBI nr
Match: gi|778679924|ref|XP_011651215.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 3.7e-09 Identity = 32/36 (88.89%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of WMU58902 vs. NCBI nr
Match: gi|502112410|ref|XP_004494322.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 isoform X1 [Cicer arietinum]) HSP 1 Score: 60.5 bits (145), Expect = 1.0e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
BLAST of WMU58902 vs. NCBI nr
Match: gi|590718273|ref|XP_007050779.1| (Flavin monooxygenase-like protein [Theobroma cacao]) HSP 1 Score: 57.4 bits (137), Expect = 8.6e-06 Identity = 25/30 (83.33%), Postives = 27/30 (90.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|