WMU58887 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CGGCAGACGCTGCGAATCGGAGGACGTCGATGTAGGTGTCGAGGCGTTTACCGATGATTGGCCAAAGTTCAGGAGGAAGATCGGACCACCGTACACGGCTGTCTTCCATGGCGGAGGCTTGACTTGAATCCGATTGGTCCAACAGAGAGACGATAAGGAGAAGAGTAGCAGTGGAT
BLAST of WMU58887 vs. NCBI nr
Match: gi|778719846|ref|XP_004134837.2| (PREDICTED: putative F-box protein At1g65770 [Cucumis sativus]) HSP 1 Score: 73.9 bits (180), Expect = 1.0e-10 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = -2
BLAST of WMU58887 vs. NCBI nr
Match: gi|659081066|ref|XP_008441132.1| (PREDICTED: F-box protein At2g17036 [Cucumis melo]) HSP 1 Score: 73.9 bits (180), Expect = 1.0e-10 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = -2
BLAST of WMU58887 vs. NCBI nr
Match: gi|449434450|ref|XP_004135009.1| (PREDICTED: putative F-box protein At1g65770 [Cucumis sativus]) HSP 1 Score: 65.9 bits (159), Expect = 2.7e-08 Identity = 26/32 (81.25%), Postives = 30/32 (93.75%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|