WMU58185 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAAATCCACCGTTATCGACGCTTTTACTTTCTGGTAACAAGTGCCCTAGTTTCACTCCGGTTCTTGCTACGGTCTCTTCGGAAGGAAGTTTCAGAGCTGGAATCGTCTCTTGAAAGGGAAGCAGCGTCACCGTCTTGTTGACGTTTCGAATTAGTCAAGTGATGTTCAACGAGATCTTTGAGAGAGAGCTCGTAAGATGATTCGGGCATGTTCCTGACCATCTCCATGAGCTCCTGTTGGCCTCTGGCTATGGCTTGGGTTCGGGAAGTTGGGGAGAGGCTGCGATTACGAGGGCGGTGAAATTGGGGCTGGTTCGAGAATTGGAACCCCAAAGCGTGGGTGAACAAACCCCGATTCCGATTGAGAGTCATCGTCGACGGCAGCAGCACTGTCCCAGCCTCTGAAAATGATGCAATC
BLAST of WMU58185 vs. TAIR10
Match: AT1G21390.1 (AT1G21390.1 embryo defective 2170) HSP 1 Score: 70.9 bits (172), Expect = 7.1e-13 Identity = 37/49 (75.51%), Postives = 38/49 (77.55%), Query Frame = -2
BLAST of WMU58185 vs. TAIR10
Match: AT1G76980.1 (AT1G76980.1 BEST Arabidopsis thaliana protein match is: embryo defective 2170 (TAIR:AT1G21390.1)) HSP 1 Score: 59.7 bits (143), Expect = 1.6e-09 Identity = 29/47 (61.70%), Postives = 34/47 (72.34%), Query Frame = -2
BLAST of WMU58185 vs. NCBI nr
Match: gi|659081933|ref|XP_008441584.1| (PREDICTED: uncharacterized protein LOC103485667 [Cucumis melo]) HSP 1 Score: 130.2 bits (326), Expect = 2.8e-27 Identity = 70/93 (75.27%), Postives = 70/93 (75.27%), Query Frame = -2
BLAST of WMU58185 vs. NCBI nr
Match: gi|449453013|ref|XP_004144253.1| (PREDICTED: uncharacterized protein LOC101219576 [Cucumis sativus]) HSP 1 Score: 125.6 bits (314), Expect = 6.9e-26 Identity = 70/94 (74.47%), Postives = 70/94 (74.47%), Query Frame = -2
BLAST of WMU58185 vs. NCBI nr
Match: gi|947116285|gb|KRH64587.1| (hypothetical protein GLYMA_04G243500 [Glycine max]) HSP 1 Score: 79.3 bits (194), Expect = 5.7e-12 Identity = 39/54 (72.22%), Postives = 46/54 (85.19%), Query Frame = -2
BLAST of WMU58185 vs. NCBI nr
Match: gi|951059060|ref|XP_014522319.1| (PREDICTED: uncharacterized protein LOC106778838 [Vigna radiata var. radiata]) HSP 1 Score: 79.0 bits (193), Expect = 7.4e-12 Identity = 39/54 (72.22%), Postives = 46/54 (85.19%), Query Frame = -2
BLAST of WMU58185 vs. NCBI nr
Match: gi|920698265|gb|KOM41490.1| (hypothetical protein LR48_Vigan04g168800 [Vigna angularis]) HSP 1 Score: 79.0 bits (193), Expect = 7.4e-12 Identity = 39/54 (72.22%), Postives = 46/54 (85.19%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|