WMU58002 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAAAAACAGGTCGAGTTCATACGCAGCTTGGAGAAAAGAGATGATCAATACAAGGCCATCCTCAACCATAAGCTCCAAAATGAGGACGACGCTGACGACAGTGGTTTGATACAGGTCTATAGTGAAGAGCTCGGTAATCGACTTGCAACATAGTCTCGGTCTCGGACCTAATTTATCTCAACAAGGGTAGGAAATTAAATTTATTTTGAACTACATATCTATCCTCATTATTGTGAATAATTTGTTTATAAAGTTGAAAAGCAAGTCAATTCCTGTGCAGCATTATGATTTTGGAAGTTATATTTTCATCAGAAAATGTACATATGAAAAGAATCCAAATAGAATGAACTAAA
BLAST of WMU58002 vs. TAIR10
Match: AT3G17470.1 (AT3G17470.1 Ca2+-activated RelA/spot homolog) HSP 1 Score: 54.3 bits (129), Expect = 5.9e-08 Identity = 25/49 (51.02%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of WMU58002 vs. Swiss-Prot
Match: CRSH_ARATH (Probable GTP diphosphokinase CRSH, chloroplastic OS=Arabidopsis thaliana GN=CRSH PE=2 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 1.0e-06 Identity = 25/49 (51.02%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of WMU58002 vs. Swiss-Prot
Match: CRSH1_ORYSJ (Probable GTP diphosphokinase CRSH1, chloroplastic OS=Oryza sativa subsp. japonica GN=CRSH1 PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 6.7e-06 Identity = 25/48 (52.08%), Postives = 34/48 (70.83%), Query Frame = 1
BLAST of WMU58002 vs. NCBI nr
Match: gi|659077050|ref|XP_008439005.1| (PREDICTED: uncharacterized protein LOC103483930 isoform X1 [Cucumis melo]) HSP 1 Score: 82.8 bits (203), Expect = 4.4e-13 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = 1
BLAST of WMU58002 vs. NCBI nr
Match: gi|659077052|ref|XP_008439006.1| (PREDICTED: uncharacterized protein LOC103483930 isoform X2 [Cucumis melo]) HSP 1 Score: 82.8 bits (203), Expect = 4.4e-13 Identity = 44/49 (89.80%), Postives = 45/49 (91.84%), Query Frame = 1
BLAST of WMU58002 vs. NCBI nr
Match: gi|449459802|ref|XP_004147635.1| (PREDICTED: probable GTP diphosphokinase CRSH, chloroplastic [Cucumis sativus]) HSP 1 Score: 80.1 bits (196), Expect = 2.8e-12 Identity = 42/49 (85.71%), Postives = 44/49 (89.80%), Query Frame = 1
BLAST of WMU58002 vs. NCBI nr
Match: gi|700202080|gb|KGN57213.1| (hypothetical protein Csa_3G171210 [Cucumis sativus]) HSP 1 Score: 80.1 bits (196), Expect = 2.8e-12 Identity = 42/49 (85.71%), Postives = 44/49 (89.80%), Query Frame = 1
BLAST of WMU58002 vs. NCBI nr
Match: gi|1000966336|ref|XP_002519327.2| (PREDICTED: probable GTP diphosphokinase CRSH, chloroplastic [Ricinus communis]) HSP 1 Score: 65.1 bits (157), Expect = 9.4e-08 Identity = 34/49 (69.39%), Postives = 43/49 (87.76%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|