WMU57881 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGGGGTGAATAGAGAAGCAAAGAAACAAATAAAACCGTCTCATTGACGAGGCAATACGTGACACAGATATTGAGGTTCTTGATCTCACTCACTTGAGTGAGTTCAGGGCAGATGCTCATCCAGCCATTTTGGTTGGGAAGAAAAGATGCAGTGGCAGTTTTGGGGACAGGACTGCATGCATTGGTGCTTACCAGGAGTCCCAGATACGTGGGTTGATATTTTGTCCCAACTCATCAGTCATCACTTAGAGACGAGATAGTTGACGATAAGGATGTATTCATTTACGAGTTCAAGATGTTTGCAGATTTTCACGAAGATCCCAAATGAAGTTCTGGTTCTTGAATCATTAAGACATTGACAAGATAAAAGGGGCATGGCTATTTTTGTGAGAGCCTATTT
BLAST of WMU57881 vs. TAIR10
Match: AT5G64470.2 (AT5G64470.2 Plant protein of unknown function (DUF828)) HSP 1 Score: 64.7 bits (156), Expect = 4.9e-11 Identity = 25/31 (80.65%), Postives = 27/31 (87.10%), Query Frame = 2
HSP 2 Score: 55.8 bits (133), Expect = 2.3e-08 Identity = 26/52 (50.00%), Postives = 35/52 (67.31%), Query Frame = 3
BLAST of WMU57881 vs. TAIR10
Match: AT5G06230.1 (AT5G06230.1 TRICHOME BIREFRINGENCE-LIKE 9) HSP 1 Score: 48.1 bits (113), Expect = 4.7e-06 Identity = 20/31 (64.52%), Postives = 23/31 (74.19%), Query Frame = 2
BLAST of WMU57881 vs. Swiss-Prot
Match: TBL12_ARATH (Protein trichome birefringence-like 12 OS=Arabidopsis thaliana GN=TBL12 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 8.7e-10 Identity = 25/31 (80.65%), Postives = 27/31 (87.10%), Query Frame = 2
HSP 2 Score: 55.8 bits (133), Expect = 4.0e-07 Identity = 26/52 (50.00%), Postives = 35/52 (67.31%), Query Frame = 3
BLAST of WMU57881 vs. NCBI nr
Match: gi|659110192|ref|XP_008455098.1| (PREDICTED: protein trichome birefringence-like 12 [Cucumis melo]) HSP 1 Score: 73.2 bits (178), Expect = 3.9e-10 Identity = 28/30 (93.33%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU57881 vs. NCBI nr
Match: gi|307136445|gb|ADN34250.1| (hypothetical protein [Cucumis melo subsp. melo]) HSP 1 Score: 73.2 bits (178), Expect = 3.9e-10 Identity = 28/30 (93.33%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU57881 vs. NCBI nr
Match: gi|449438268|ref|XP_004136911.1| (PREDICTED: protein trichome birefringence-like 12 [Cucumis sativus]) HSP 1 Score: 72.0 bits (175), Expect = 8.7e-10 Identity = 27/30 (90.00%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU57881 vs. NCBI nr
Match: gi|1021023882|gb|KZM81670.1| (hypothetical protein DCAR_029283 [Daucus carota subsp. sativus]) HSP 1 Score: 71.2 bits (173), Expect = 1.5e-09 Identity = 29/32 (90.62%), Postives = 29/32 (90.62%), Query Frame = 2
BLAST of WMU57881 vs. NCBI nr
Match: gi|747081451|ref|XP_011087997.1| (PREDICTED: protein trichome birefringence-like 12 [Sesamum indicum]) HSP 1 Score: 70.1 bits (170), Expect = 3.3e-09 Identity = 27/30 (90.00%), Postives = 30/30 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|