WMU57708 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCCGTACCAACATTTCTAAATTTCGGTTGGCCTTTGCTTTGGCTTGTTTCTGGGAGTGGCAAACACTGATAGTCTTTTATATGACGATGAATTCAGCAAGTATCTTAAGGACTATCCAGATAACTTCCGCTATGATCGAGCTCTTAGCAGGGAGCAAAAGAACAAGAGTGGAGGAAAAAATGTAATGTCCAGGACAAGATTGAGGAGTACGGCGACGAAATCTTT
BLAST of WMU57708 vs. TAIR10
Match: AT1G30510.2 (AT1G30510.2 root FNR 2) HSP 1 Score: 85.9 bits (211), Expect = 1.2e-17 Identity = 38/45 (84.44%), Postives = 42/45 (93.33%), Query Frame = 2
HSP 2 Score: 29.6 bits (65), Expect = 9.9e-01 Identity = 15/26 (57.69%), Postives = 18/26 (69.23%), Query Frame = 1
BLAST of WMU57708 vs. TAIR10
Match: AT4G05390.1 (AT4G05390.1 root FNR 1) HSP 1 Score: 81.3 bits (199), Expect = 2.8e-16 Identity = 36/45 (80.00%), Postives = 40/45 (88.89%), Query Frame = 2
HSP 2 Score: 29.6 bits (65), Expect = 9.9e-01 Identity = 15/26 (57.69%), Postives = 18/26 (69.23%), Query Frame = 1
BLAST of WMU57708 vs. TAIR10
Match: AT5G66190.1 (AT5G66190.1 ferredoxin-NADP(+)-oxidoreductase 1) HSP 1 Score: 53.1 bits (126), Expect = 8.3e-08 Identity = 26/45 (57.78%), Postives = 29/45 (64.44%), Query Frame = 2
BLAST of WMU57708 vs. TAIR10
Match: AT1G20020.1 (AT1G20020.1 ferredoxin-NADP(+)-oxidoreductase 2) HSP 1 Score: 53.1 bits (126), Expect = 8.3e-08 Identity = 29/59 (49.15%), Postives = 34/59 (57.63%), Query Frame = 2
BLAST of WMU57708 vs. Swiss-Prot
Match: FENR2_PEA (Ferredoxin--NADP reductase, root isozyme, chloroplastic OS=Pisum sativum PE=2 SV=2) HSP 1 Score: 88.6 bits (218), Expect = 3.1e-17 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = 2
HSP 2 Score: 29.3 bits (64), Expect = 2.3e+01 Identity = 13/16 (81.25%), Postives = 11/16 (68.75%), Query Frame = 1
BLAST of WMU57708 vs. Swiss-Prot
Match: FENR2_TOBAC (Ferredoxin--NADP reductase, root-type isozyme, chloroplastic OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.2e-16 Identity = 40/45 (88.89%), Postives = 39/45 (86.67%), Query Frame = 2
HSP 2 Score: 30.0 bits (66), Expect = 1.3e+01 Identity = 16/26 (61.54%), Postives = 17/26 (65.38%), Query Frame = 1
BLAST of WMU57708 vs. Swiss-Prot
Match: FNRR2_ARATH (Ferredoxin--NADP reductase, root isozyme 2, chloroplastic OS=Arabidopsis thaliana GN=RFNR2 PE=1 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.0e-16 Identity = 38/45 (84.44%), Postives = 42/45 (93.33%), Query Frame = 2
HSP 2 Score: 29.6 bits (65), Expect = 1.8e+01 Identity = 15/26 (57.69%), Postives = 18/26 (69.23%), Query Frame = 1
BLAST of WMU57708 vs. Swiss-Prot
Match: FENR3_ORYSJ (Ferredoxin--NADP reductase, embryo isozyme, chloroplastic OS=Oryza sativa subsp. japonica GN=Os07g0147900 PE=1 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.5e-16 Identity = 38/45 (84.44%), Postives = 41/45 (91.11%), Query Frame = 2
HSP 2 Score: 29.3 bits (64), Expect = 2.3e+01 Identity = 13/16 (81.25%), Postives = 11/16 (68.75%), Query Frame = 1
BLAST of WMU57708 vs. Swiss-Prot
Match: FENR2_ORYSJ (Ferredoxin--NADP reductase, root isozyme, chloroplastic OS=Oryza sativa subsp. japonica GN=Os03g0784700 PE=1 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 5.9e-16 Identity = 38/45 (84.44%), Postives = 40/45 (88.89%), Query Frame = 2
HSP 2 Score: 29.3 bits (64), Expect = 2.3e+01 Identity = 13/16 (81.25%), Postives = 11/16 (68.75%), Query Frame = 1
BLAST of WMU57708 vs. NCBI nr
Match: gi|659078108|ref|XP_008439552.1| (PREDICTED: ferredoxin--NADP reductase, root isozyme, chloroplastic [Cucumis melo]) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-16 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 2
BLAST of WMU57708 vs. NCBI nr
Match: gi|703106707|ref|XP_010098567.1| (Ferredoxin--NADP reductase, root isozyme [Morus notabilis]) HSP 1 Score: 92.8 bits (229), Expect = 2.7e-16 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 2
BLAST of WMU57708 vs. NCBI nr
Match: gi|571514213|ref|XP_006597058.1| (PREDICTED: uncharacterized protein LOC100807968 isoform X1 [Glycine max]) HSP 1 Score: 92.0 bits (227), Expect = 4.6e-16 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 2
BLAST of WMU57708 vs. NCBI nr
Match: gi|358248040|ref|NP_001239798.1| (uncharacterized protein LOC100807968 [Glycine max]) HSP 1 Score: 92.0 bits (227), Expect = 4.6e-16 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 2
BLAST of WMU57708 vs. NCBI nr
Match: gi|955365686|ref|XP_014622849.1| (PREDICTED: uncharacterized protein LOC100807968 isoform X2 [Glycine max]) HSP 1 Score: 92.0 bits (227), Expect = 4.6e-16 Identity = 44/45 (97.78%), Postives = 45/45 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|