WMU56769 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GAAGAAAGAAATGGGAAGGCATTCGACAACCTTTGTTGTTGTTCTTATTGTTCTTCTTATTCCGACCGAGATTTTTTGTTATTCCGAAAAAGAAATAAAACGTTGGTGTAGCCAAACGCCATAATCCAGCTCCATGTGAGGAATTTCTCAAAACCAAAGCCTTAACAAACAAATCTCCAATAGTCAATAAATCCCATTTCTTTGAAATCTTAGTCCAAACGGCACTCGAACGTGCCGTTTCGGCCCCATAAAAACGCTCTTTCTCTCGGCCCAAAATGCCGAAATAGT
BLAST of WMU56769 vs. NCBI nr
Match: gi|449432283|ref|XP_004133929.1| (PREDICTED: pectinesterase 2 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 3.7e-10 Identity = 34/40 (85.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of WMU56769 vs. NCBI nr
Match: gi|659075527|ref|XP_008438193.1| (PREDICTED: pectinesterase 2 [Cucumis melo]) HSP 1 Score: 68.9 bits (167), Expect = 5.3e-09 Identity = 35/41 (85.37%), Postives = 36/41 (87.80%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|