WMU54984 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGAATGCGTGCTGGGCTTGCAGCATCTGCCATCGCCTTAGTTAAAGTTGCAATTCCACTCATTCTCTGCATAAAGTTCAGTGCCACCTTTCAGCTACAAGGATGCTTTTGTGCTTGCCCAAAGTCAGCAGAATCTTCTGCAAGGGCTAACTGGATGATGCCACACAGATCATAGGTAGGGTGAGATGGAGGCTGGATTGCTACTGATGCAACTGATATCCCAGAATCTTTGGATACAGATGTAGACATTGCAATAATTTTCCTGGAACCTAAGCCGTGAGCAGTAGAGATTGGAATGTGTGTTAACCCTCTAGAACAGCCACGCAATCCT
BLAST of WMU54984 vs. TAIR10
Match: AT2G01350.1 (AT2G01350.1 quinolinate phoshoribosyltransferase) HSP 1 Score: 51.6 bits (122), Expect = 3.5e-07 Identity = 28/39 (71.79%), Postives = 29/39 (74.36%), Query Frame = -2
HSP 2 Score: 48.5 bits (114), Expect = 3.0e-06 Identity = 24/49 (48.98%), Postives = 31/49 (63.27%), Query Frame = -2
BLAST of WMU54984 vs. Swiss-Prot
Match: NADC_ARATH (Nicotinate-nucleotide pyrophosphorylase [carboxylating], chloroplastic OS=Arabidopsis thaliana GN=QPT PE=2 SV=2) HSP 1 Score: 51.6 bits (122), Expect = 6.3e-06 Identity = 28/39 (71.79%), Postives = 29/39 (74.36%), Query Frame = -2
HSP 2 Score: 48.5 bits (114), Expect = 5.3e-05 Identity = 24/49 (48.98%), Postives = 31/49 (63.27%), Query Frame = -2
BLAST of WMU54984 vs. NCBI nr
Match: gi|659109569|ref|XP_008454775.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 119.8 bits (299), Expect = 3.0e-24 Identity = 63/70 (90.00%), Postives = 64/70 (91.43%), Query Frame = -2
BLAST of WMU54984 vs. NCBI nr
Match: gi|659109573|ref|XP_008454777.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 118.2 bits (295), Expect = 8.7e-24 Identity = 62/71 (87.32%), Postives = 64/71 (90.14%), Query Frame = -2
BLAST of WMU54984 vs. NCBI nr
Match: gi|778730689|ref|XP_011659842.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 112.8 bits (281), Expect = 3.7e-22 Identity = 61/70 (87.14%), Postives = 62/70 (88.57%), Query Frame = -2
BLAST of WMU54984 vs. NCBI nr
Match: gi|659109575|ref|XP_008454778.1| (PREDICTED: nicotinate-nucleotide pyrophosphorylase [carboxylating]) HSP 1 Score: 78.6 bits (192), Expect = 7.7e-12 Identity = 40/44 (90.91%), Postives = 41/44 (93.18%), Query Frame = -2
BLAST of WMU54984 vs. NCBI nr
Match: gi|661896179|emb|CDP00757.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 64.3 bits (155), Expect = 1.5e-07 Identity = 31/74 (41.89%), Postives = 48/74 (64.86%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|