WMU54043 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAATGCGACATTTACGGCACCGTCGATTTCATCTTCGGCAACGCCGCCGTCGTAATCCAAGATTCCAACATCATCGCTCGTGATCCTCCGAACAAAACCATCACACTCACCGCCCAAGGCCGCCACCCGAGGGTCCGTAAGGTCAGAACACCGGAATCTCCATCCACAATTGCAGAGTC
BLAST of WMU54043 vs. TAIR10
Match: AT2G45220.1 (AT2G45220.1 Plant invertase/pectin methylesterase inhibitor superfamily) HSP 1 Score: 64.3 bits (155), Expect = 2.9e-11 Identity = 29/40 (72.50%), Postives = 32/40 (80.00%), Query Frame = 1
BLAST of WMU54043 vs. TAIR10
Match: AT4G00190.1 (AT4G00190.1 pectin methylesterase 38) HSP 1 Score: 62.8 bits (151), Expect = 8.3e-11 Identity = 28/41 (68.29%), Postives = 31/41 (75.61%), Query Frame = 1
BLAST of WMU54043 vs. TAIR10
Match: AT1G02810.1 (AT1G02810.1 Plant invertase/pectin methylesterase inhibitor superfamily) HSP 1 Score: 57.8 bits (138), Expect = 2.7e-09 Identity = 27/42 (64.29%), Postives = 31/42 (73.81%), Query Frame = 1
BLAST of WMU54043 vs. TAIR10
Match: AT4G02330.1 (AT4G02330.1 Plant invertase/pectin methylesterase inhibitor superfamily) HSP 1 Score: 57.4 bits (137), Expect = 3.5e-09 Identity = 28/42 (66.67%), Postives = 30/42 (71.43%), Query Frame = 1
BLAST of WMU54043 vs. TAIR10
Match: AT4G02300.1 (AT4G02300.1 Plant invertase/pectin methylesterase inhibitor superfamily) HSP 1 Score: 57.0 bits (136), Expect = 4.6e-09 Identity = 27/43 (62.79%), Postives = 31/43 (72.09%), Query Frame = 1
BLAST of WMU54043 vs. Swiss-Prot
Match: PME2_CITSI (Pectinesterase 2 OS=Citrus sinensis GN=PECS-2.1 PE=2 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 1.9e-12 Identity = 33/41 (80.49%), Postives = 35/41 (85.37%), Query Frame = 1
BLAST of WMU54043 vs. Swiss-Prot
Match: PME17_ARATH (Probable pectinesterase/pectinesterase inhibitor 17 OS=Arabidopsis thaliana GN=PME17 PE=2 SV=2) HSP 1 Score: 64.3 bits (155), Expect = 5.1e-10 Identity = 29/40 (72.50%), Postives = 32/40 (80.00%), Query Frame = 1
BLAST of WMU54043 vs. Swiss-Prot
Match: PME38_ARATH (Putative pectinesterase/pectinesterase inhibitor 38 OS=Arabidopsis thaliana GN=PME38 PE=3 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.5e-09 Identity = 28/41 (68.29%), Postives = 31/41 (75.61%), Query Frame = 1
BLAST of WMU54043 vs. Swiss-Prot
Match: PME7_ARATH (Probable pectinesterase/pectinesterase inhibitor 7 OS=Arabidopsis thaliana GN=PME7 PE=2 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 4.7e-08 Identity = 27/42 (64.29%), Postives = 31/42 (73.81%), Query Frame = 1
BLAST of WMU54043 vs. Swiss-Prot
Match: PME41_ARATH (Probable pectinesterase/pectinesterase inhibitor 41 OS=Arabidopsis thaliana GN=PME41 PE=2 SV=2) HSP 1 Score: 57.4 bits (137), Expect = 6.2e-08 Identity = 28/42 (66.67%), Postives = 30/42 (71.43%), Query Frame = 1
BLAST of WMU54043 vs. NCBI nr
Match: gi|449432283|ref|XP_004133929.1| (PREDICTED: pectinesterase 2 [Cucumis sativus]) HSP 1 Score: 83.6 bits (205), Expect = 1.3e-13 Identity = 39/41 (95.12%), Postives = 40/41 (97.56%), Query Frame = 1
BLAST of WMU54043 vs. NCBI nr
Match: gi|659075527|ref|XP_008438193.1| (PREDICTED: pectinesterase 2 [Cucumis melo]) HSP 1 Score: 82.4 bits (202), Expect = 2.9e-13 Identity = 38/41 (92.68%), Postives = 40/41 (97.56%), Query Frame = 1
BLAST of WMU54043 vs. NCBI nr
Match: gi|976903303|gb|KVH91211.1| (Pectinesterase, active site-containing protein [Cynara cardunculus var. scolymus]) HSP 1 Score: 76.6 bits (187), Expect = 1.6e-11 Identity = 36/41 (87.80%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of WMU54043 vs. NCBI nr
Match: gi|703108167|ref|XP_010098938.1| (Pectinesterase 2 [Morus notabilis]) HSP 1 Score: 75.1 bits (183), Expect = 4.6e-11 Identity = 34/41 (82.93%), Postives = 38/41 (92.68%), Query Frame = 1
BLAST of WMU54043 vs. NCBI nr
Match: gi|697149003|ref|XP_009628696.1| (PREDICTED: pectinesterase 2 [Nicotiana tomentosiformis]) HSP 1 Score: 75.1 bits (183), Expect = 4.6e-11 Identity = 34/41 (82.93%), Postives = 38/41 (92.68%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|