WMU53760 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGATGGAATTCATCGGTGGAAGCCGTCGCTAACGGCGTGCCGGTGGTGGCGTTCCCGCAGTTGGGGGATCAAGTGACCAACGCAAAAGTTTCTGGTGGAGGAATATGGAGTTGGAGTGAGGCTGTCCCGTGGAGCAGAGGCAAGTGATTTGATTACGAGAGATGAGATTGAGAGGTGCTTGTCGGAGGTGATGATCGGCGGCAGTGGGGAGAGGAAAATTCAGGCAAAATGCTTTGAAATGGAAAAAGGCGGCAGCGGCGGCTGTGGCGGACGGCGGCTCCTCCGCCCGTAACTTCCAAGAGTTGTTGATGAGATTAGACAGAGATCTTTAAGAGGTTAAGTGTCCCATTTAAACTCTTGTACGTGTGTTTTGATAAAATCATCGGTCACATTGTATCACGTTTCTTCGA
BLAST of WMU53760 vs. TAIR10
Match: AT3G21560.1 (AT3G21560.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 50.1 bits (118), Expect = 1.3e-06 Identity = 26/48 (54.17%), Postives = 30/48 (62.50%), Query Frame = 1
HSP 2 Score: 35.0 bits (79), Expect = 4.3e-02 Identity = 19/56 (33.93%), Postives = 28/56 (50.00%), Query Frame = 2
BLAST of WMU53760 vs. TAIR10
Match: AT4G15500.1 (AT4G15500.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 49.3 bits (116), Expect = 2.2e-06 Identity = 20/28 (71.43%), Postives = 23/28 (82.14%), Query Frame = 1
HSP 2 Score: 34.3 bits (77), Expect = 7.3e-02 Identity = 14/46 (30.43%), Postives = 24/46 (52.17%), Query Frame = 2
BLAST of WMU53760 vs. Swiss-Prot
Match: UGT_FRAAN (Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa GN=GT5 PE=2 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 4.6e-06 Identity = 24/29 (82.76%), Postives = 23/29 (79.31%), Query Frame = 1
HSP 2 Score: 51.2 bits (121), Expect = 1.0e-05 Identity = 24/56 (42.86%), Postives = 35/56 (62.50%), Query Frame = 2
BLAST of WMU53760 vs. Swiss-Prot
Match: F6CGT_GENTR (UDP-glycosyltransferase UF6CGT1 OS=Gentiana triflora GN=UF6CGT1 PE=2 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 6.0e-06 Identity = 21/29 (72.41%), Postives = 24/29 (82.76%), Query Frame = 1
HSP 2 Score: 48.9 bits (115), Expect = 5.1e-05 Identity = 24/42 (57.14%), Postives = 28/42 (66.67%), Query Frame = 2
BLAST of WMU53760 vs. NCBI nr
Match: gi|659109998|ref|XP_008454994.1| (PREDICTED: limonoid UDP-glucosyltransferase-like [Cucumis melo]) HSP 1 Score: 83.6 bits (205), Expect = 3.0e-13 Identity = 42/87 (48.28%), Postives = 51/87 (58.62%), Query Frame = 2
BLAST of WMU53760 vs. NCBI nr
Match: gi|449438647|ref|XP_004137099.1| (PREDICTED: limonoid UDP-glucosyltransferase-like [Cucumis sativus]) HSP 1 Score: 80.1 bits (196), Expect = 3.3e-12 Identity = 43/89 (48.31%), Postives = 52/89 (58.43%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|