WMU53465 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TACCCTCACTTCCTGAGGACCTGGCGCCTGAAGAAGACGGTTCTGCACCCGGGGTGGAGTTGTCTCTCCGGTCTAATTGCTGCTTCAAGGAGTATTTAGCAAGATATTCAGCTCTTGAAGCTTCCATCACCATCTGCTCAATCTCTTTTTCAGTAACCTCAAGATCTGAGAAATACCGTCCTTGAGCAAGAAGAGCGTTATCAAGCTGTTGATCTTGCTGTGCTTTTAAAGCAGCCTTCACCTTATCCTTGTCAACATTTTGCCCCCTCGAAGACTGCTGAATCCAAGCCCTGCACCAATTGTTAAGCGACGTGGATCAACAAGAGAGTTGTAATGATTTCCATGATGATAGCTCAACCGAATGGGAGCAGGTCAGTAGCATAGTTCCATGAAGTATTAATAGGTTCTGTGCCATAGG
BLAST of WMU53465 vs. TAIR10
Match: AT2G27350.5 (AT2G27350.5 OTU-like cysteine protease family protein) HSP 1 Score: 70.5 bits (171), Expect = 9.4e-13 Identity = 31/34 (91.18%), Postives = 30/34 (88.24%), Query Frame = -2
HSP 2 Score: 52.8 bits (125), Expect = 2.0e-07 Identity = 26/43 (60.47%), Postives = 35/43 (81.40%), Query Frame = -1
BLAST of WMU53465 vs. NCBI nr
Match: gi|778659493|ref|XP_011654529.1| (PREDICTED: OTU domain-containing protein 5-B [Cucumis sativus]) HSP 1 Score: 85.5 bits (210), Expect = 8.0e-14 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -1
BLAST of WMU53465 vs. NCBI nr
Match: gi|659071632|ref|XP_008461136.1| (PREDICTED: OTU domain-containing protein 5-B [Cucumis melo]) HSP 1 Score: 85.5 bits (210), Expect = 8.0e-14 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -1
BLAST of WMU53465 vs. NCBI nr
Match: gi|147860016|emb|CAN81048.1| (hypothetical protein VITISV_021902 [Vitis vinifera]) HSP 1 Score: 76.6 bits (187), Expect = 3.7e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of WMU53465 vs. NCBI nr
Match: gi|955350974|ref|XP_014619606.1| (PREDICTED: OTU domain-containing protein 5-like isoform X2 [Glycine max]) HSP 1 Score: 76.6 bits (187), Expect = 3.7e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of WMU53465 vs. NCBI nr
Match: gi|296084879|emb|CBI28288.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 76.6 bits (187), Expect = 3.7e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|