WMU53301 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTAGTTTCTGCAAACCAGTTCAGGTTAGCAGAAACACTTCTTGATAGGATGAAGGAGGAGAAAATTGATGTCACTGAGGATATACTTCTCTCCATTTGTAGGGCTTATGGTCGTATCCATAAGCCATTGGATTCCATAAGAGTTTTCCATAAAATGCAGGATTTTCCATTGCAAGCCTACAGAGAAGTCTTACATTTCAGTGCTTGCCATTCTTGTGGAAGAGAATCAATTAAGATTAGCTTTTAGATTTTATAGGTATATGAGAAAAGTAGGTATTCCCCCTACTGTAGCTTCTCTTAATGTTCTAATCAAAGCCTTTTGTAAGAATAGTGTAACCATGGAAAAAGCAATACACATTTTTCGTGAAATGTCTAACT
BLAST of WMU53301 vs. TAIR10
Match: AT5G46100.1 (AT5G46100.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 99.0 bits (245), Expect = 2.2e-21 Identity = 45/73 (61.64%), Postives = 59/73 (80.82%), Query Frame = 2
HSP 2 Score: 81.6 bits (200), Expect = 3.7e-16 Identity = 38/55 (69.09%), Postives = 44/55 (80.00%), Query Frame = 1
BLAST of WMU53301 vs. TAIR10
Match: AT3G48810.1 (AT3G48810.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 55.8 bits (133), Expect = 2.2e-08 Identity = 30/79 (37.97%), Postives = 46/79 (58.23%), Query Frame = 2
HSP 2 Score: 34.7 bits (78), Expect = 5.1e-02 Identity = 19/65 (29.23%), Postives = 31/65 (47.69%), Query Frame = 2
BLAST of WMU53301 vs. TAIR10
Match: AT1G74580.1 (AT1G74580.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 47.4 bits (111), Expect = 7.7e-06 Identity = 24/71 (33.80%), Postives = 37/71 (52.11%), Query Frame = 2
BLAST of WMU53301 vs. Swiss-Prot
Match: PP418_ARATH (Pentatricopeptide repeat-containing protein At5g46100 OS=Arabidopsis thaliana GN=At5g46100 PE=2 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 3.9e-20 Identity = 45/73 (61.64%), Postives = 59/73 (80.82%), Query Frame = 2
HSP 2 Score: 81.6 bits (200), Expect = 6.5e-15 Identity = 38/55 (69.09%), Postives = 44/55 (80.00%), Query Frame = 1
BLAST of WMU53301 vs. Swiss-Prot
Match: PP270_ARATH (Pentatricopeptide repeat-containing protein At3g48810 OS=Arabidopsis thaliana GN=At3g48810 PE=2 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 3.8e-07 Identity = 30/79 (37.97%), Postives = 46/79 (58.23%), Query Frame = 2
HSP 2 Score: 34.7 bits (78), Expect = 9.1e-01 Identity = 19/65 (29.23%), Postives = 31/65 (47.69%), Query Frame = 2
BLAST of WMU53301 vs. NCBI nr
Match: gi|659068118|ref|XP_008442845.1| (PREDICTED: pentatricopeptide repeat-containing protein At5g46100 isoform X1 [Cucumis melo]) HSP 1 Score: 128.6 bits (322), Expect = 7.4e-27 Identity = 62/71 (87.32%), Postives = 67/71 (94.37%), Query Frame = 2
BLAST of WMU53301 vs. NCBI nr
Match: gi|778658822|ref|XP_004146658.2| (PREDICTED: pentatricopeptide repeat-containing protein At5g46100 [Cucumis sativus]) HSP 1 Score: 127.5 bits (319), Expect = 1.7e-26 Identity = 62/75 (82.67%), Postives = 68/75 (90.67%), Query Frame = 2
BLAST of WMU53301 vs. NCBI nr
Match: gi|700209609|gb|KGN64705.1| (hypothetical protein Csa_1G075590 [Cucumis sativus]) HSP 1 Score: 127.5 bits (319), Expect = 1.7e-26 Identity = 62/75 (82.67%), Postives = 68/75 (90.67%), Query Frame = 2
BLAST of WMU53301 vs. NCBI nr
Match: gi|567914199|ref|XP_006449413.1| (hypothetical protein CICLE_v10015063mg [Citrus clementina]) HSP 1 Score: 111.3 bits (277), Expect = 1.2e-21 Identity = 55/75 (73.33%), Postives = 63/75 (84.00%), Query Frame = 2
BLAST of WMU53301 vs. NCBI nr
Match: gi|568826734|ref|XP_006467725.1| (PREDICTED: pentatricopeptide repeat-containing protein At5g46100 [Citrus sinensis]) HSP 1 Score: 111.3 bits (277), Expect = 1.2e-21 Identity = 55/75 (73.33%), Postives = 63/75 (84.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|