WMU53228 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGTAACCATGTTTACGGCACAGAATTCCAGTCTATGCTGGATGGATTTGAGGAAGAAGGGTGCGTTGAGGAATCGGGGCGATGTTTCTAGAGAAGAAAAGGACGACTTAGTGTGGAGCAAGTGAAGG
BLAST of WMU53228 vs. NCBI nr
Match: gi|658006783|ref|XP_008338560.1| (PREDICTED: homeobox-leucine zipper protein ATHB-6-like [Malus domestica]) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-06 Identity = 29/42 (69.05%), Postives = 33/42 (78.57%), Query Frame = 1
BLAST of WMU53228 vs. NCBI nr
Match: gi|802673601|ref|XP_012081624.1| (PREDICTED: homeobox-leucine zipper protein ATHB-6-like [Jatropha curcas]) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-06 Identity = 29/42 (69.05%), Postives = 33/42 (78.57%), Query Frame = 1
BLAST of WMU53228 vs. NCBI nr
Match: gi|470103473|ref|XP_004288161.1| (PREDICTED: homeobox-leucine zipper protein ATHB-6-like isoform X2 [Fragaria vesca subsp. vesca]) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-06 Identity = 29/42 (69.05%), Postives = 33/42 (78.57%), Query Frame = 1
BLAST of WMU53228 vs. NCBI nr
Match: gi|764515533|ref|XP_011465283.1| (PREDICTED: homeobox-leucine zipper protein ATHB-6-like isoform X1 [Fragaria vesca subsp. vesca]) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-06 Identity = 29/42 (69.05%), Postives = 33/42 (78.57%), Query Frame = 1
BLAST of WMU53228 vs. NCBI nr
Match: gi|590706919|ref|XP_007047858.1| (Alanine--glyoxylate aminotransferase 2 isoform 1 [Theobroma cacao]) HSP 1 Score: 59.3 bits (142), Expect = 1.9e-06 Identity = 28/42 (66.67%), Postives = 33/42 (78.57%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|