WMU52873 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAAGCGCCGCCCCAGGTTTCGCATTACGAATCTAACCCCTCCAAACAACGATGGCAATGGACGAGATCCCCTTCGAAAACGGGTCGTCCGTTAATTCACCGACCTTGGCATGAGAGACCGTACCTGGTTTCAATTGAACTGACTTCTCGTTCCATTGGTTGCTTTCTGGG
BLAST of WMU52873 vs. NCBI nr
Match: gi|778676625|ref|XP_011650623.1| (PREDICTED: vacuolar protein sorting-associated protein 8 homolog [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 4.1e-09 Identity = 35/55 (63.64%), Postives = 41/55 (74.55%), Query Frame = -2
BLAST of WMU52873 vs. NCBI nr
Match: gi|659074757|ref|XP_008437780.1| (PREDICTED: vacuolar protein sorting-associated protein 8 homolog [Cucumis melo]) HSP 1 Score: 67.4 bits (163), Expect = 9.1e-09 Identity = 34/57 (59.65%), Postives = 41/57 (71.93%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|