WMU52788 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCAGGAAGACGAAGCCTCTTCTAGATTCAAAGTGCATCGAAGAGACAAATTTTCATTACAGGATGGACGACGAGCTGTGCATGAACATTGAGGGGGCGAATTAGTTTTCCTACTGGTAGTTTGGTCGATT
BLAST of WMU52788 vs. NCBI nr
Match: gi|659074121|ref|XP_008437433.1| (PREDICTED: BTB/POZ domain-containing protein At3g05675 [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 3.7e-07 Identity = 26/32 (81.25%), Postives = 29/32 (90.62%), Query Frame = 3
BLAST of WMU52788 vs. NCBI nr
Match: gi|778699260|ref|XP_011654681.1| (PREDICTED: BTB/POZ domain-containing protein At3g05675 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 3.7e-07 Identity = 26/32 (81.25%), Postives = 29/32 (90.62%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|