WMU51088 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCATGCTCGGCCTCTTCGTTGGGTCCTTCTGCAAGCAACTAACAGCCACATTCATCACATCCATCAAACTCTCCATTGGGCACGATTGCTCGAAAAGAGCTTCATCAATCCAACTCCTCAATCTTTTCCAACTTCTCCTTCTCCTTCCCCTACCAAAAACCCACTACTGGCGCTCATCCATAGAACCCCTCCTTCGTCGTCAACAGCCTCCTTCCCAGAGATCAGCTCGAGCAGAACAACTCCAAACGAGA
BLAST of WMU51088 vs. NCBI nr
Match: gi|778678340|ref|XP_011650952.1| (PREDICTED: lysM domain receptor-like kinase 4 [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.1e-10 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = -2
BLAST of WMU51088 vs. NCBI nr
Match: gi|659076279|ref|XP_008438594.1| (PREDICTED: lysM domain receptor-like kinase 4 [Cucumis melo]) HSP 1 Score: 74.3 bits (181), Expect = 1.1e-10 Identity = 35/36 (97.22%), Postives = 35/36 (97.22%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|