|
|
The following sequences are available for this feature:
transcribed_cluster sequence GAATTCCGTTTTGCCGAATTGTTTGCAAGAATTGATGCTGTTGATGCAAGCACAATTAAAACGTGTTGCGAATCGGTTTATTATGATAGGGATGTCGCAATTGCCGCTATTGGGGTCCCAATTCCAAGGTTTGCCTTGACTACAACTGGTTCAGACG
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
| Term | Definition |
|---|
| IPR011237 | Peptidase M16 domain |
Vocabulary: Molecular Function
| Term | Definition |
|---|
| GO:0046872 | metal ion binding |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
| Category |
Term Accession |
Term Name |
| molecular_function |
GO:0046872 |
metal ion binding |
This transcribed_cluster is associated with the following gene feature(s):
| Feature Name | Unique Name | Type |
|---|
| Cla001475 | Cla001475 | gene |
The following EST feature(s) are a part of this transcribed_cluster:
| Feature Name | Unique Name | Type |
|---|
| S1_0045082 | S1_0045082 | EST |
|
