WMU50836 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATTAAGCCCTTCACGGCGGAGGCAAAGACCCAAACGGAAACCGCGCATCAGCCTTTTGTGGCTCTGGAAGAGGATCATATCGAACAGATGATTGAGGAATTGATTCATTATGGGTCTGTTGAGCTCTGTTCTATTGTACCACCGTCTCCGGCGTTTTGAAATTAATTAAACGAAAGCCCATTTTGGTCGAACTTTTGGGATTACATAAAATATTATTAGTAGTGTTTTCTTGGATTTAGTTCTACTGGATGATTAACAATTAGGCTATCTGTATAATCCGATTATCTTAATGTACT
BLAST of WMU50836 vs. TAIR10
Match: AT5G25190.1 (AT5G25190.1 Integrase-type DNA-binding superfamily protein) HSP 1 Score: 57.0 bits (136), Expect = 7.6e-09 Identity = 28/45 (62.22%), Postives = 32/45 (71.11%), Query Frame = 1
BLAST of WMU50836 vs. Swiss-Prot
Match: ERF03_ARATH (Ethylene-responsive transcription factor ERF003 OS=Arabidopsis thaliana GN=ERF003 PE=2 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.3e-07 Identity = 28/45 (62.22%), Postives = 32/45 (71.11%), Query Frame = 1
BLAST of WMU50836 vs. NCBI nr
Match: gi|659088964|ref|XP_008445254.1| (PREDICTED: ethylene-responsive transcription factor ERF003-like [Cucumis melo]) HSP 1 Score: 94.4 bits (233), Expect = 1.2e-16 Identity = 44/52 (84.62%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of WMU50836 vs. NCBI nr
Match: gi|449442154|ref|XP_004138847.1| (PREDICTED: ethylene-responsive transcription factor ERF003-like [Cucumis sativus]) HSP 1 Score: 94.4 bits (233), Expect = 1.2e-16 Identity = 44/52 (84.62%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of WMU50836 vs. NCBI nr
Match: gi|694312827|ref|XP_009363957.1| (PREDICTED: ethylene-responsive transcription factor ERF003 [Pyrus x bretschneideri]) HSP 1 Score: 65.1 bits (157), Expect = 7.9e-08 Identity = 27/42 (64.29%), Postives = 35/42 (83.33%), Query Frame = 1
BLAST of WMU50836 vs. NCBI nr
Match: gi|657945205|ref|XP_008378704.1| (PREDICTED: ethylene-responsive transcription factor ERF003-like [Malus domestica]) HSP 1 Score: 65.1 bits (157), Expect = 7.9e-08 Identity = 27/42 (64.29%), Postives = 35/42 (83.33%), Query Frame = 1
BLAST of WMU50836 vs. NCBI nr
Match: gi|658016807|ref|XP_008343757.1| (PREDICTED: ethylene-responsive transcription factor ERF003-like [Malus domestica]) HSP 1 Score: 64.3 bits (155), Expect = 1.3e-07 Identity = 27/42 (64.29%), Postives = 35/42 (83.33%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|