WMU50349 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CATCGAACGCCTCGCCAATCGCAATCAAACTCGCTTAGAGAATTCCATAACCCGCAGATCGGAGTCCGATTCCTCTTCCTCTTCCACTTCGTCGTTTCTAGTCCGCTTTTCCGACTCCAAGCGCGCCATCGAGTCTGAACTCGCCCAATGCCGCCTCACGCTGCCGGAGCCCACTCAGCTCAGATCTCACCTCGATGGGGATATCCACCTCAATCTCCGACCTCGAGAAGTCTGGGTCGTCCCTTCCAAA
BLAST of WMU50349 vs. NCBI nr
Match: gi|449458285|ref|XP_004146878.1| (PREDICTED: tubulin-folding cofactor C [Cucumis sativus]) HSP 1 Score: 67.0 bits (162), Expect = 1.8e-08 Identity = 37/66 (56.06%), Postives = 38/66 (57.58%), Query Frame = 2
BLAST of WMU50349 vs. NCBI nr
Match: gi|659107707|ref|XP_008453815.1| (PREDICTED: tubulin-folding cofactor C [Cucumis melo]) HSP 1 Score: 63.5 bits (153), Expect = 1.9e-07 Identity = 36/66 (54.55%), Postives = 37/66 (56.06%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|