WMU49576 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTTTCAATATGTATACAAAGCTGGCTATAGCGTTGTGCAGACAGATACCATAATAATCTTGTTGATGCTGCAGAGGCGCAAGCACTTGATGTGCAAGAAGCTTCCTGCCATGACCATGAGCAGTCCTTCTGAATCAGATGTGCCATTTTCTCTTGAAGAATGAAGTTGTGAATGGTATAGAAAACTTGCTGCATTTTCTGCTGAGGTAGATAACATCATTGGAATATTATTCCCCTGCCACTTCTACTAATTTTTCTTTCCTTCT
BLAST of WMU49576 vs. TAIR10
Match: AT1G24040.1 (AT1G24040.1 Acyl-CoA N-acyltransferases (NAT) superfamily protein) HSP 1 Score: 51.6 bits (122), Expect = 2.9e-07 Identity = 24/34 (70.59%), Postives = 26/34 (76.47%), Query Frame = 2
BLAST of WMU49576 vs. NCBI nr
Match: gi|449434885|ref|XP_004135226.1| (PREDICTED: uncharacterized protein LOC101210740 [Cucumis sativus]) HSP 1 Score: 84.3 bits (207), Expect = 1.1e-13 Identity = 45/52 (86.54%), Postives = 45/52 (86.54%), Query Frame = 2
BLAST of WMU49576 vs. NCBI nr
Match: gi|659090858|ref|XP_008446240.1| (PREDICTED: uncharacterized protein LOC103489030 [Cucumis melo]) HSP 1 Score: 82.8 bits (203), Expect = 3.3e-13 Identity = 45/53 (84.91%), Postives = 45/53 (84.91%), Query Frame = 2
BLAST of WMU49576 vs. NCBI nr
Match: gi|567891871|ref|XP_006438456.1| (hypothetical protein CICLE_v10032202mg [Citrus clementina]) HSP 1 Score: 66.6 bits (161), Expect = 2.4e-08 Identity = 36/53 (67.92%), Postives = 40/53 (75.47%), Query Frame = 2
BLAST of WMU49576 vs. NCBI nr
Match: gi|641863879|gb|KDO82565.1| (hypothetical protein CISIN_1g021820mg [Citrus sinensis]) HSP 1 Score: 66.6 bits (161), Expect = 2.4e-08 Identity = 36/53 (67.92%), Postives = 40/53 (75.47%), Query Frame = 2
BLAST of WMU49576 vs. NCBI nr
Match: gi|567891873|ref|XP_006438457.1| (hypothetical protein CICLE_v10032202mg [Citrus clementina]) HSP 1 Score: 66.6 bits (161), Expect = 2.4e-08 Identity = 36/53 (67.92%), Postives = 40/53 (75.47%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|