WMU48949 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTTCCATGATGATGAAGTCTCCAAAGTCAGCCACAACTATGATCCAGCATAGACATTTTGGCATTTTAACGCCTGGAGCACCGGGGTCGAAATATGTAAGAGGATGGCATGGTGGAGTCATTAGGGAGGATATAAGGCAATGGATGTTGCAAAATTAGAAACCAAGTCGATTGTTTGTTTGTTTTTTTTCTTTCTCTTCTTT
BLAST of WMU48949 vs. NCBI nr
Match: gi|659095578|ref|XP_008448656.1| (PREDICTED: uncharacterized protein LOC103490759 [Cucumis melo]) HSP 1 Score: 89.7 bits (221), Expect = 2.0e-15 Identity = 40/51 (78.43%), Postives = 44/51 (86.27%), Query Frame = 3
BLAST of WMU48949 vs. NCBI nr
Match: gi|449462045|ref|XP_004148752.1| (PREDICTED: uncharacterized protein LOC101208416 [Cucumis sativus]) HSP 1 Score: 88.6 bits (218), Expect = 4.5e-15 Identity = 40/51 (78.43%), Postives = 43/51 (84.31%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|